Labshake search
Citations for New England Biolabs :
3251 - 3300 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 100 ng of RNA was reverse-transcribed into cDNA using the LunaScript RT Master Mix Kit (New England Biolabs #E3025L). qPCR reactions utilized specific primers and were performed in triplicate with Applied Biosystems TaqMan Gene Expression Master Mix (ThermoFisher #4369016) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and both homology arms were ordered as gBlocks from Integrated DNA Technologies (IDT) and assembled (NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF254, cTF255) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF256, cTF257) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... were assembled in 3 separate reactions for 15 minutes at 50 °C or 55 °C using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs E2621S) alongside a control reaction omitting the insert ...
-
bioRxiv - Developmental Biology 2024Quote: ... The donor DNA construct containing both homology arms (pENTR-HAL-mCherry-HAR; 5853 bp) was created using the NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621). The following primers were used for amplifying each DNA fragment.
-
bioRxiv - Developmental Biology 2024Quote: ... the regulatory region of each gene was inserted into SmaI digested pUC19 together with GFP amplified from pPD95.75 using NEBuilder® HiFi DNA Assembly Master Mix (NEB - E2621). PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The above two sets of PCR products were gel purified and cloned in a pUAST-attB vector digested with EcoRI using NEBuilder HiFi DNA Assembly Master Mix (NEB # E2621L). Transfected cells were lysed in RIPA buffer (140mM NaCl ...
-
bioRxiv - Developmental Biology 2024Quote: ... FLAG-tagged MyoID was generated for this study by cloning cDNA clone SD01662 from Drosophila Genomics Research Center (DGRC) into a pUAST vector using NEBuilder HiFi DNA Assembly Master Mix (NEB # E2621L). Plasmids encoding different Ds-ICD motif deletion constructs with a C-terminal V5-tag were created in this study ...
-
bioRxiv - Genomics 2024Quote: ... Amplicons were then barcoded for NGS by combining 2 µL of amplicon from the previous PCR with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492) and 500 nM forward and reverse indexing primers (Integrated DNA Technologies) ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the BC-sgRNA1-sgRNA2 region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2× Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Neuroscience 2022Quote: ... and P7-index-Read2-EGFP (CAAGCAGAAGACGGCATACGAGATAGGATTCGGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGgCATGGACGAGCTGTACAAG) (200 nM each) were used as primers with the NEBNext Ultra II Q5 Master Mix (NEB, M0544L). Amplification was performed using the following PCR protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized fragments and linearized vectors were ligated using NEBuilder HiFi DNA Assembly Master Mix (Cat# E2612L, New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2023Quote: ... The first round was performed with primer pairs listed in Supplementary Table S7 with 16 cycles using NEBNext High Fidelity Master Mix (NEB, # M0541) for the screens with EpiC and Tiling libraries and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Systems Biology 2023Quote: We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles ...
-
bioRxiv - Pathology 2023Quote: ... cDNA then was used as a template for barcoding PCR following ONT’s protocol (SQK-LSK110 with EXP-PBC096) and LongAmp Taq 2× Master Mix (NEB, Ipswich, MA). The barcoded amplicons were bead purified at a 0.8× beads:solution ratio before being pooled by equal volume with libraries from unrelated samples and a library generated from HeLa RNA (ThermoFisher)
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...
-
bioRxiv - Microbiology 2022Quote: Constructs for the generation of knockout mutants were assembled by Gibson assembly (Gibson et al., 2009) using NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, USA). To generate a plasmid for the knockout of Synpcc7942_1510 (SigF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligation of the plasmid was carried out via Gibson assembly using NEB builder HiFi DNA assembly master mix as per manufacturer’s instructions (New England Biolabs; catalog # M5520AA2) and transfected into NEB5α bacteria ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid assembly was performed by in vitro Gibson Assembly using a HiFi DNA Assembly master mix (New England Biolabs, Ipswich, MA), downscaled to 5 µL reaction volumes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the two were combined by Gibson assembly (Gibson et al. 2009) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs Inc.) in 20 µL reactions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The resulting three fragments and the vector were fused using the Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, USA) at 50 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... the native barcodes were ligated with the Native Barcoding Expansion 96 (EXP-NBD196) and NEB Blunt/TA Ligase Master Mix (NEB, M0367) selecting a unique barcode per sample ...
-
bioRxiv - Biochemistry 2023Quote: ... synthesized by Twist Biosciences and inserted into a pET expression vector via Gibson Assembly using NEBuilder® HiFi DNA Assembly Master Mix (NEB) following NEB protocols ...
-
bioRxiv - Microbiology 2023Quote: ... custom adapters (Table S1) were ligated using a NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, E6040S), and the transposon-genome junction was amplified with primers (Table S1 ...
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Plant Biology 2023Quote: ... Type-IIS cloning was performed as described previously (Cai et al., 2020) using a Master Mix containing 10% (v/v) 10× T4 DNA ligase buffer (NEB #M0202), 2.5% (v/v ...
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... The unique barcoded region was amplified from 500ng genomic DNA with 16 cycles of PCR using NEBNext Ultra II Q5 master mix (NEB M0544L) as described in30 ...
-
bioRxiv - Molecular Biology 2023Quote: ... full length CDS of TaSnRK1α gene was amplified using the wheat cDNA and cloned into the pCAMBIA1302 vector under the constitutive promoter 35S using the Gibson assembly cloning kit (Gibson Assembly® Master Mix, NEB) with the help of restriction enzyme NcoI ...
-
bioRxiv - Molecular Biology 2023Quote: ... A minimum of 6 PCR reactions were set up per sample and 200 ng of genomic DNA was used per reaction using NEB Q5 Hot Start High-Fidelity master mix (NEB M0494) with PCR1 conditions ...
-
bioRxiv - Genomics 2023Quote: ... The amplified fragments were cloned via Gibson assembly (using NEBuilder HiFi DNA Assembly Master Mix; New England BioLabs, cat. No. E2621L) into the SbfI/AgeI site of the pLS-SceI vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCRs were conducted in volumes of 30 μL comprising a Phusion® High-Fidelity PCR Master Mix (New England Biolabs) (15 μL) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Double-stranded oligonucleotides corresponding to synthetic enhancers with gibson arms were synthesized by IDT (GeneBlock) and assembled into targeting vector using 5 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S), 36 ng of linearized vector ...
-
bioRxiv - Microbiology 2023Quote: ... Mixing the linearised pCRISPR-cBEST plasmid and Del-ptaA with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, USA). The linearised pCRISPR-cBEST plasmid was then bridged by Del-ptaA ...
-
bioRxiv - Genomics 2023Quote: ... then the linearized backbone and the annealed duplex were ligated at room temperature for 20 minutes using the Blunt/TA Ligase Master Mix (NEB M0367S). Transformation ...
-
bioRxiv - Genetics 2022Quote: ... Two independent lines were successfully established and PCR validated through single fly PCR (Gloor et al., 1993) using OneTaq PCR master mix (NEB #M0271L). Primers for PCR were designed to flank the integration site (primer sequences ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed in a total volume of 50 μL with 4.0 μg genomic DNA per reaction using NEBNext Ultra II Q5 Master Mix (New England Biolabs, Ipswich, MA) (98 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR sgRNA resistant synonymous or functional domain point mutations were introduced by PCR mutagenesis using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2631). Stable cell lines were generated using the pLU vectors and selected with puromycin or blasticidin ...
-
bioRxiv - Genomics 2022Quote: ... signal constructs were amplified by PCR from different plasmids and assembled using the NEBuilder HiFi DNA Assembly Master Mix (HiFi Assembly, NEB #E2621). The BxbI attP site was then added using the Q5 Site-Directed Mutagenesis Kit (Q5 SDM ...
-
bioRxiv - Physiology 2023Quote: ... The gel-purified PCR products were cloned into the EcoRI- digested pBluescript II SK(+) vector using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, E2621X). The mixture of pU6b-sgRNA and targeting vector was microinjected into w1118 ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid assembly was performed by in vitro Gibson assembly using a HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich MA), downscaled to 5 µL reaction volume ...