Labshake search
Citations for New England Biolabs :
3601 - 3650 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA was diluted to 0.2 ng.μl-1 and 1 ng was analysed by qPCR using Luna Universal qPCR MasterMix (NEB) with 500nM of primers ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dissected tissue was then washed 2X in chilled nuclei extraction buffer (NEB: 10 mM HEPES ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The marker and samples were mixed with 2X RNA loading dye (NEB) and heat denatured at 90 °C for 3 mins before snap cooling on ice for 2 min prior to loading ...
-
bioRxiv - Cell Biology 2022Quote: Wash 2x with 200 μL of 1x CutSmart Buffer (New England BioLabs) with 2 min incubation RT ...
-
bioRxiv - Biophysics 2019Quote: ... PCR reactions were set up using 2x Q5 mastermix (NEB, cat# M0492), 10 ng of plasmid template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The marker and samples were mixed with 2X RNA loading dye (NEB) and heat denatured at 90 °C for 3 mins before snap cooling on ice for 2 min prior to loading ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended in 5 μL of 2X RNA loading dye (New England Biolabs) and heated 5 min at 75° C ...
-
bioRxiv - Biophysics 2021Quote: PCR reactions were set up using 2x Q5 mastermix (NEB, cat#M0492), 10 ng of plasmid template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µL Q5 Hot Start 2x MasterMix (New England Biolabs, Ipswich, MA), and 0.5 µL 10 µM 5’ Bio-ISPCR oligo ([Btn]AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Cell Biology 2023Quote: ... The RNA pellet was resuspended in 2X RNA loading dye (NEB®) and heated for 5 min at 70°C ...
-
bioRxiv - Genomics 2023Quote: ... Then we added 13 μl of Q5 Ultra II (NEB, 2x mastermix), 1 μl S5 primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of 2X protein synthesis buffer (New England Biolabs, Beverly, MA), 0.25 μL of RNaseOUT RNAse inhibitor (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: All subsequent amplifications for cloning purposes used Q5 2X MasterMix (NEB, M0492). Knockout constructs were created by amplifying either a KanMX or HygR resistance marker from a parent plasmid with two sets of overlapping 60nt primer pairs ...
-
bioRxiv - Plant Biology 2021Quote: ... and were quantified by qPCR (E7630, NEB). The 2×150 bp paired-end sequencing with average insert size of 700 bp was performed by Welgene Biotech on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Physiology 2021Quote: ... LUNA Universal Probe qPCR Mastermix (NEB, #M3004E) and 1,5 μM of primers in a total volume of 5μl were used ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna qPCR Mastermix (NEB, Frankfurt, Germany) was used for amplification on an 7500 Fast Real-Time PCR System (Applied Biosystems™).
-
bioRxiv - Biochemistry 2021Quote: ... The denaturing PAGE gel used the Low Range ssRNA Ladder (NEB; Markers ...
-
bioRxiv - Biochemistry 2021Quote: ... The denaturing PAGE gels used the Low Range ssRNA Ladder (NEB; Markers ...
-
bioRxiv - Biochemistry 2021Quote: ... The denaturing PAGE gel used the Low Range ssRNA Ladder (NEB; Markers ...
-
bioRxiv - Biochemistry 2021Quote: ... Denaturing urea-PAGE gels used the Low Range ssRNA Ladder (NEB). The resulting gels were stained with SYBR Gold and scanned on a Sapphire™ Biomolecular Imager (Azure Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The denaturing PAGE gels used the Low Range ssRNA Ladder (NEB; Markers ...
-
bioRxiv - Biochemistry 2021Quote: ... The denaturing PAGE gels used the Low Range ssRNA Ladder (NEB; Markers ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 7.5 µL of low molecular weight DNA ladder (NEB, #N3233) was loaded onto the gel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ssRNA ladder and Low range ssRNA ladder standards (New England Biolabs) were used ...
-
bioRxiv - Biochemistry 2022Quote: ... along with a low MW (molecular weight)-range RNA ladder (NEB). SYBR Gold-stained gels were imaged to determine the fraction of intact RNA in each sample ...
-
bioRxiv - Developmental Biology 2024Quote: ... NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB #E6420) was used for cDNA synthesis ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 uL of NEB Golden Gate Enzyme Mix (BsmBI-v2) Mix (NEB, E1602L), and molbio grade water added to a total of 50uL reaction solution ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and RT-qPCR was performed using the Luna Universal Onestep RT-qPCR kit (New England Biolabs, Ipswich, Massachusetts, USA) on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Genomics 2021Quote: ... 1% of the cDNA was used for each qPCR reaction performed with the Luna Universal qPCR Mastermix (NEB M3003) and the PCR primers listed (Supplementary Table1) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR was conducted in technical triplicate using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... All qPCRs were performed using the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) and a Step One Plus qPCR machine (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... and PCR-amplified with Q5 Hotstart high-fidelity 2X mastermix (NEB, Cat #M0494) and barcoding primers (Table S7 ...
-
bioRxiv - Genomics 2020Quote: ... All PCR amplification was performed using 2X Q5 UltraII Mastermix (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... 2X hybridisation buffer (4X SSC, 20% dextran sulphate, 2 mg/mL BSA (NEB), 1/10 volume nuclease free water and 1/10 volume vanadyl-ribonucleoside complex (VRC ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted in 15ul 2x first strand cDNA synthesis buffer (NEBnext, NEB). After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (Ultra Directional RNA Library Prep ...
-
bioRxiv - Bioengineering 2021Quote: The ligation reaction was diluted to 1X with 2X RNA loading dye (NEB). Standards (low range ssRNA ladder ...
-
bioRxiv - Biochemistry 2020Quote: ... Inserts were amplified by PCR using Q5 2x Hotstart mastermix (NEB, Ipswich, MA), and purified by agarose gel purification and extraction (primers ...
-
bioRxiv - Microbiology 2021Quote: ... 12.5 µL Hot Start Taq DNA Polymerase (2X (New England Biolabs, Ipswich, USA), and 9.25 µL sterile water ...
-
bioRxiv - Genomics 2021Quote: ... and amplified using NEBNext High-Fidelity 2x PCR MasterMix (New England BioLabs M0541) with the Nextera primer Ad1 (1.25 µM ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR-1 was carried out using 2X Taq polymerase mastermix (New England BioLabs) while PCR-2 and PCR-3 were carried out using dATP ...
-
bioRxiv - Genomics 2023Quote: ... 2X hybridisation buffer (4X SSC, 20% dextran sulphate, 2 mg/mL BSA (NEB), 1/10 volume nuclease free water and 1/10 volume vanadyl-ribonucleoside complex (VRC ...