Labshake search
Citations for New England Biolabs :
3351 - 3400 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The L gene was assembled into a pIRES vector digested NheI and XbaI using the NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) according to manufacturer instructions to generate pCMV-Lopt ...
-
bioRxiv - Microbiology 2024Quote: ... the kanamycin resistance cassette could be removed by restriction digestion and a respective PCR fragment containing the E T9I mutation and with overlapping ends was introduced by Gibson assembly using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621). This PCR fragment was amplified using cDNA from a patient sample containing the E T9I mutation with the primers Efwd gcacaagctgatgagtacgaactt and Erev gaaaaactaatataatatttagttcg ...
-
bioRxiv - Bioengineering 2021Quote: ... Standards (low range ssRNA ladder, NEB) and 10 pmol of unligated tRNA sample were prepared in an equivalent buffer to the first ligation reaction (1X RNA Ligase 2 buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The low range ssRNA ladder (NEB) was used as molecular weight marker.
-
bioRxiv - Synthetic Biology 2022Quote: ... The low range ssRNA ladder (NEB) was used as a molecular weight marker.
-
bioRxiv - Immunology 2022Quote: ... Low range ssRNA Ladder (NEB, N0364S) and dsRNA Ladder (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The low range ssRNA ladder (NEB) was used as a molecular weight marker.
-
bioRxiv - Synthetic Biology 2022Quote: ... The low range ssRNA ladder (NEB) was used as a molecular weight marker.
-
bioRxiv - Synthetic Biology 2022Quote: ... The low range ssRNA ladder (NEB) was used as a molecular weight marker.
-
bioRxiv - Genetics 2022Quote: ... pipientis infection status by qPCR (NEB Luna Universal qPCR kit) using primer sets for wsp and arm (S1 Table) ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed with Luna Universal qPCR reagent (NEB). eMLV env was detected with 5’-AGGCTGTTCCAGAGATTGTG-3’ and 5’-TTCTGGACCACCACATGAC-3’ and 18S rRNA was detected with 5’-GTAACCCGTTGAACCCCATT-3’ and 5’-CCATCCAATCGGTAGTAGCG-3’ on Roche LightCycler 480 II (104,105).
-
bioRxiv - Genomics 2021Quote: ... qRT-PCR was subsequently performed with primers specific for edited genes and fly sequences using Luna Universal qPCR Mix (New England Biolabs, Ipswich, Massachusetts) and Biorad CFX ConnectTM Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Physiology 2023Quote: ... 300nmol-L of a gene specific primer (thermofisher scientific, USA) and 10uL of Syber green qPCR mastermix (New England Biolabs, Ipswich, Massachusetts, USA) each used as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... qPCRs were carried out using the Luna Universal qPCR MasterMix (NEB) with the primers listed in Supplementary Table 3 and measured on an Applied Biosystems 7500 Real-Time PCR system ...
-
bioRxiv - Synthetic Biology 2022Quote: ... To perform the qPCR assay 0.95 µL qPCR mastermix (M3003, NEB) containing 2 ng/µL template DNA was dispensed using a nanoliter dispenser (Cobra 4-channel dispenser ...
-
bioRxiv - Cancer Biology 2021Quote: ... the following construct was synthesized as gBlocks and assembled using Gibson assembly (Master Mix Cat # E2611S, New England Biolabs, Ipswich, MA, USA). The FLAG-tagged coding sequence of RRM1 was joined via a P2A cassette to the 6x-His tagged coding sequence of RRM2 ...
-
bioRxiv - Genetics 2021Quote: ... and assembly of the recombinant vector was performed with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). To generate the double ΔnoxA Δyap1 knockout mutant ...
-
bioRxiv - Microbiology 2020Quote: ... all three fragments had 20 base pair overlap sequences and were assembled by NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA). All constructs were verified by Sanger sequencing prior to transformation into the B ...
-
bioRxiv - Microbiology 2021Quote: ... as well as for ectopic MEDLE2 expression were constructed by Gibson assembly using NEB Gibson Assembly Master Mix (New England Biolabs, Ipswich. MA). A linear repair template was generated by PCR ...
-
bioRxiv - Developmental Biology 2020Quote: The lft2 exon regions were amplified by PCR from genomic DNA isolated from tail fin clips of a surface fish and individual F61 PA-CF male and females using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA) and the primers listed in Table S3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... v1g105193) and the amplified fragment was cloned into a pCR4 backbone using the NEBuilder® HiFi DNA Assembly master mix (NEB, E2621). For sub-cloning into the NvPOU4::mCherry plasmid (52 ...
-
bioRxiv - Systems Biology 2022Quote: ... The 4 fragments were assembled using Gibson’s isothermal assembly: 500ng of total amplified fragments were combined with 10μl of NEBuilder HiFi DNA assembly master mix (NEB cat. no. E2621L) and water to 20μl ...
-
bioRxiv - Systems Biology 2022Quote: ... of CROPseq-CaptureSeq-Guide-Puro backbone and 400 fmoles (18.31ng) of amplified dsDNA oligonucleotides were combined with 10 μl of NEBuilder HiFi DNA assembly master mix (NEB cat. no. E2621L) and water to 20 μl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... in vivo homologous recombination in Saccharomyces cerevisiae BJ5464 or isothermal assembly with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, MA, USA). In all cloning procedures we used E ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using half total volume of eluted ChIP DNA and NEBNext® DNA Library Prep Master Mix Set and Multiplex Oligos for Illumina® (New England Biolabs). Library quality was assessed using Bioanalyzer 2100 High Sensitivity DNA Gels (Agilent) ...
-
bioRxiv - Molecular Biology 2019Quote: ... novel donor template for AAV) were assembled in a ratio of 1:2 with Gibson (HiFi) DNA Assembly Master Mix (NEB, cat# E2621S) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... gRNAs were individually cloned into NF-Cas9-yDHOD(-) using DNA assembly reactions (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs®, Inc.). The TetR-DOZI-aptamer conditional knockdown system was kindly provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... PCR reactions for library preparation were performed by adding the following to the 10 μL DNA sample: 25 μL of Phusion High-fidelity PCR Master Mix (NEB catalog # M0531S), 1 μL of 5’ library index barcode ...
-
bioRxiv - Microbiology 2019Quote: ... Earth Microbiome primers and thermocycler protocol (Caporaso et al., 2012) in 25-μl reactions containing Phusion High-fidelity Master Mix (New England Biolabs, Ipswich, MA), 0.25μM of each primer ...
-
bioRxiv - Cell Biology 2019Quote: ... with the mCherry tag from the pET28 mCherry plasmid using NEB Gibson Assembly (Gibson Assembly Master Mix, New England BioLabs, Cat. # E2611S). See Table EV10 for primer sequences.
-
bioRxiv - Cell Biology 2019Quote: ... and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix, New England BioLabs, Cat. # E2611S) (see Table EV7 for primer sequences) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µl of genomic DNA was used for screening by PCR amplification (Phusion® High-Fidelity PCR Master Mix with HF Buffer, NEB, M0531S) of the targeted genomic region ...
-
bioRxiv - Immunology 2021Quote: ... CITE-seq library amplification is performed following SPRI bead purification of CITE-seq cDNA using Q5 Hot Start HiFi Master Mix (New England Biolabs, Ipswich, MA), SI PCR primer (IDT ...
-
bioRxiv - Synthetic Biology 2021Quote: All the plasmids used in this study were generated by Gibson Assembly using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, E2621L) as per manufactory’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... libraries were prepared using NEBNext® Ultra II DNA Library Prep Master Mix Set and Multiplex Oligos for Illumina® (New England Biolabs). Library quality was assessed using Bioanalyzer 2100 High Sensitivity DNA Gels (Agilent) ...
-
bioRxiv - Pathology 2021Quote: ... flanks fragments of bcptp1 gene were amplified and respectively cloned into the upstream and downstream regions of hph cassette using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA). The overexpression plasmid OEBcPTP1- pH2G was generated that the full-length open reading frame of bcptp1 was cloned into the pH2G vector under the regulation of B ...
-
bioRxiv - Plant Biology 2021Quote: ... nigrum young leaf and peduncle cDNA using c70979_Fw and c70979_Rv primer and cloned into the pEAQ-HT vector(50) using NruI-HF and SmaI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... the linearized vector was assembled with a GBlock (Dataset S5) carrying the proD promoter (60) using HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA). Vectors used to construct plasmids containing the bbu genes were linearized by PCR amplification from 10 ng vector template DNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5 ...
-
bioRxiv - Biochemistry 2021Quote: ... Vectors used to construct plasmids containing the bbu genes were linearized by PCR amplification from 10 ng vector template DNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). Thermocycling was carried out in a Bio-Rad C100 thermal cycler using the following parameters ...
-
bioRxiv - Biochemistry 2021Quote: ... timonensis SN18 gDNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). A plasmid based on the pET28a(+ ...
-
bioRxiv - Microbiology 2020Quote: ... The two fragments were then gel purified and assembled in vitro using the NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genes of interest were cloned into the pLenti CMVTRE3G eGFP Neo (w821-1) plasmid using a Gibson Assembly Master Mix kit (Cat# E2611S, New England Biolabs, Ipswich, MA). pLenti CMV rtTA3 Blast (w756-1 ...
-
bioRxiv - Microbiology 2020Quote: ... native barcode ligation using the EXP-NBD103 barcode kit (Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase master mix (New England Biolabs, Ipswich, MA) was performed as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Microbiology 2020Quote: ... In-frame deletions of ulaG (VCA0248) and crp (VC2614) were constructed using a Gibson assembly protocol and HiFi DNA assembly master mix (New England Biolabs, Ipswich, MA). Gene fragments were amplified using primer pairs VC_ulaG_A/VC_ulaG_B and VC_ulaG_C/VC_ulaG_D or VC_CRP_A/VC_CRP_B and VC_CRP_C/VC_CRP_D ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... were used to clone plasmids using a combination of standard molecular cloning techniques and Gibson Assembly (master mix from New England Biolabs, Ipswich, MA). The plasmid pJS167 (45 ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... CITE-seq library amplification is performed following SPRI bead purification of CITE-seq cDNA using Q5 Hot Start HiFi Master Mix (New England Biolabs, Ipswich, MA), SI PCR primer (IDT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and lin-41(tn1894[dendra::tev::3xflag::lin-41]) were generated by Gibson assembly using the NEBuilder HiFi DNA Assembly master mix (New England Biolabs, Ipswich, MA) and five different PCR products ...
-
bioRxiv - Genomics 2022Quote: ... The amplified products were fused and introduced into pFC332 using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, MA, USA). The vectors containing the sgRNA were then transformed into competent Escherichia coli TOP10 cells for multiplication overnight ...