Labshake search
Citations for New England Biolabs :
3551 - 3600 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... barcoded using PCR reaction (LongAmpTaq 2x New England Biolabs, USA), then 1.2x AmPure beads (Beckmann-Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and resuspended in 10 μL 2x RNA Loading Dye (NEB). Resuspended RNAs were incubated at 72°C for five min and resolved on 15% polyacrylamide 7 M urea gels ...
-
bioRxiv - Bioengineering 2022Quote: ... The RNAs were denatured in 2X RNA Loading Dye (NEB) at 70°C for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was performed using 2X Phusion HF Mastermix (NEB M0531L) in 10 μL reactions with 20 ng of template DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: After the addition of the RNA loading dye 2x (NEB) and the heat denaturation at 65 °C for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... or Q5 Hot Start High-Fidelity 2x Mastermix (M0492, NEB) in a 15 μL reaction ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using a Luna ® Universal One-Step RT-qPCR kit (NEB) in a CFX96 qPCR thermocycler (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (E3005S, NEB). 20μl reactions using 200nM primers and <100ng RNA were run on ABI StepOnePlus Real Time PCR system following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was done with 100ng of RNA with the Luna RT-qPCR kit (NEB) using primers targeting beta actin as a control (Table S2) ...
-
bioRxiv - Synthetic Biology 2024Quote: RT-qPCR was conducted using Luna®Universal One-Step RT-qPCR Kit (NEB E3005L) following the manufacturer’s documentation ...
-
bioRxiv - Microbiology 2024Quote: ... in comparison to low molecular weight ssRNA (NEB #N0364S). Gels were cut on a blue light box corresponding to the size of tRNAs (70 to 100 nt ...
-
bioRxiv - Molecular Biology 2024Quote: ... with TriDye Ultra Low Range DNA ladder (NEB, N0558S) and run at 100V for ∼50 minutes ...
-
bioRxiv - Genomics 2024Quote: ... together with the low range ssRNA ladder (NEB, 0364S).
-
bioRxiv - Developmental Biology 2023Quote: ... protocol for low input RNA (NEB, Cat no #E6420). The quality and quantity of the resulting library was analyzed on an Agilent bioanalyzer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Upon preparation of the PCR mix (NEBNext Q5 mix, NEB) following the instructions of the manufacturer ...
-
bioRxiv - Systems Biology 2019Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs). 1 μl of 10-fold diluted RNA was added to 4 μl of rtPCR mix and subjected to a reverse transcription step at 55°C and 45 cycles of PCR (10 seconds at 95°C and 30 seconds at 60°C) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs). Primers targeting the MS2 stem-loop regions were used for quantifying repeat RNA expression levels ...
-
bioRxiv - Immunology 2020Quote: ... Real time qPCR was performed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Zoology 2024Quote: ... RT-qPCR was performed using the Luna One-step RT-qPCR kit (New England Biolabs, Germany) on a 384 well-plate with 3 technical replicates per biological replicate in CFX384 Touch Real-Time PCR (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... with Luna Universal qPCR Mastermix (NEB). For analysis of Aicda mRNA decay ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25μL Q5 Hot Start 2x MasterMix (New England Biolabs, Ipswich, MA), and 0.5μL 10μM 5’ Bio-ISPCR oligo ([Btn]AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Genetics 2022Quote: ... The PCR reaction contained 25 μl 2x Q5 DNA Polymerase (NEB), 2.5 μl K1F (10 μM) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR reaction contained 25 μl 2x Q5 DNA Polymerase (NEB), 2.5 μl K2.F (10 μM) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... reaction was stopped by adding 2X RNA gel-loading buffer (NEB) with urea ...
-
bioRxiv - Microbiology 2021Quote: ... and amplified with OneTaq 2x MasterMix solution (New England Biolabs, MA) mixed with T ...
-
bioRxiv - Cancer Biology 2024Quote: ... Amplicons were generated with the Q5 2x mastermix (New England Biolabs) and cloned by GoldenGate assembly into pCFD5w (Addgene 112645 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... the PCR reaction mixture consisted of 2x Q5 HotStart Mastermix (NEB), 500nM primer-F ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified using 2X Q5 Hot-Start Mastermix (NEB #M0494) with primers that add the indexed full Illumina adaptor sequences.
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µL 2X Q5 high fidelity Mastermix (New England Biolabs, M0492S), 0.5 µM forward primer (LC1020) ...
-
bioRxiv - Microbiology 2024Quote: ... using the 2X Gibson Assembly Kit (Cat # E2611S, New England Biolabs). Assembled constructs were confirmed by whole plasmid sequencing (Plasmidsaurus ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mounted in 1% low melting point agarose (LMP) (Biolabs) within a 1mm diameter glass capillary ...
-
bioRxiv - Microbiology 2020Quote: ... next to an RNA marker (low range ssRNA ladder; NEB) and run at 200 V for 45 minutes ...
-
bioRxiv - Systems Biology 2020Quote: ... and desalted (Monarch low volume elution columns, New England Biolabs) for electroporation into Endura electrocompetent cells (Lucigen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Low range ssRNA Ladder (New England BioLabs, Cat no N0364S) and 10 pmol of broccoli were run alongside the transcriptions as controls ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Cell Biology 2019Quote: ... DNTP mix (Biolabs, 447)) using following primers ...