Labshake search
Citations for New England Biolabs :
3351 - 3400 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μl of each PCR reaction was amplified with barcoded primers to reconstitute the TruSeq adaptors using the Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... regions flanking each target site were PCR amplified using locus-specific primers bearing tails complementary to the TruSeq Illumina adapters as described previously.13 25-50ng input genomic DNA is PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Molecular Biology 2022Quote: The regions of interest (supplementary Table 1) were PCR amplified (supplementary table 3) from the extracted DNA using Q5 high-fidelity DNA polymerase (NEB). Of the primers used in the PCRs (supplementary table 2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 ng of genomic DNA from genome-targeting experiments were PCR amplified with 30-cycles using Q5 High-fidelity DNA Polymerase (NEB) and primers which bind just outside of TS2 or just inside of LE ...
-
bioRxiv - Molecular Biology 2022Quote: ... including 12.5 μL of Q5® Hot-Start High-Fidelity 2X Master Mix (New England Biolabs® Inc., MA, USA), 1.5 µL of each indexed primer (10 µM ...
-
bioRxiv - Microbiology 2022Quote: ... The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using Q5 High-Fidelity 2X Master Mix (NEB). For PCR-I ...
-
bioRxiv - Developmental Biology 2022Quote: Full-length cDNAs for wnt11b.L were amplified from wildtype or wnt11b-/- mutant oocyte total RNA using a high-fidelity polymerase (Q5, New England Biolabs). PCR products were cloned into pCR8/GW/TOPO (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... The three primer pairs were pooled in a multiplex PCR reaction using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) in a 25 μL final volume as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... a ~1-1.5Kb fragment that included guide-RNA target sites was PCR amplified using Q5 High-Fidelity DNA Polymerase (NEB; M0491). Primers were designed using the NCBI Primer Blast tool and are documented in the key resources table ...
-
bioRxiv - Microbiology 2022Quote: ... DNA library was prepared by PCR amplification using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs). The resulting PCR products were purified by QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones identified as edited had the target ends amplified by PCR with high-fidelity Taq polymerase (Pfusion HF; NEB, M030) and sent for Sanger sequencing (Genewiz ...
-
bioRxiv - Developmental Biology 2022Quote: ... The solution was directly used as a template for PCR amplification using Q5® High-Fidelity 2X Master Mix (NEB) (primer pair ...
-
bioRxiv - Microbiology 2022Quote: ... using high fidelity Phusion Hot Start Flex DNA polymerase enzyme and 5X Phusion HF buffer (New England Biolabs, UK, M0535). Library preparation was performed using the NEB ultra DNA library preparation kit for Illmina (E7370 ...
-
bioRxiv - Microbiology 2022Quote: ... We performed PCR amplification of vector and insert fragments with Q5 high-fidelity polymerase (New England Biolabs, Frankfurt/Main, Germany), followed by DpnI restriction enzyme digest when necessary ...
-
bioRxiv - Bioengineering 2022Quote: ... site-directed mutagenesis was performed on pCMV-BE3 by amplifying the plasmid using the oligonucleotides SDM-dCBE-Fwd and SDM-dCBE-Rev (Supplementary Table S1) using Phusion High-Fidelity DNA Polymerase (NEB). The resulting plasmids were incubated with DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Target loci were amplified using a proof-reading polymerase (Q5® High-Fidelity DNA Polymerase, New England Biolabs, Ipswich, MA) and primers flanking the target sites (Supplementary Table S8) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5μg genomic DNA of each tumor was used as template in a pre-amplification reaction using unique barcoded primer combination for each tumor with 20 cycles and Q5 High-Fidelity DNA Polymerase (NEB). The following primers were used:
-
bioRxiv - Cell Biology 2022Quote: Template DNA for producing DIG-labelled RNA probes were obtained by PCR by using Q5 High-Fidelity DNA polymerase (M0491S, New England Biolabs) with the primers listed in Table S2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5ul of PCR1 product as template was amplified using unique i5 and i7 index primer combinations with 8 cycles and Q5 High-Fidelity DNA Polymerase (NEB) for each individual sample to allow pooling of sequencing libraries ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs); 0.2 μM each of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A volume of 3.5 μl of the Cre reaction was then used for PCR amplification using the high-fidelity enzyme Q5 (NEB, M0530L) as described above.
-
bioRxiv - Microbiology 2020Quote: ... the primers BT_1927_XbaI-DR and BT_1927_SalI-UF were used to amplify the BT1927-ON and BT1927-OFF promoters from the previously-constructed BT1927-ON and BT1927-OFF strains35 via colony PCR using Q5 High Fidelity DNA polymerase (New England Biolabs). Candidate Δcps BT1927-ON and Δcps BT1927-OFF mutants were screened and confirmed by PCR using the primer pair BT1927_Diagnostic_R and BT1927_Diagnostic_F and confirmed by Sanger sequencing using these diagnostic primers ...
-
bioRxiv - Microbiology 2020Quote: A DNA fragment including the estimated promoter region and coding region of hm1275 was obtained byPCR with Q5 High-Fidelity DNA Polymerase (New England BioLabs) using S ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting gDNA was used as template for PCR amplification of the shRNA encoding regions using the Fw-NGS and the Rev-NGS primers (IDT Technologies) and the Phusion High Fidelity DNA polymerase (NEB). Three PCRs per condition were performed and the amplicons combined ...
-
bioRxiv - Microbiology 2020Quote: ... A 56-nt ssDNA oligonucleotide encoding a central tract of 20 degenerate nucleotides (oBFC1397) was amplified with BsmBI-encoding primers oBFC1398 and oBFC1399 using Q5 High-Fidelity 2X Master Mix (NEB) in a six-cycle PCR (98°C for 1 min ...
-
bioRxiv - Genetics 2022Quote: ... The resulting PCR products were used in a PCR to add Gateway attB sites: 25 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 µL PCR product ...
-
bioRxiv - Microbiology 2022Quote: ... All primers and synthesized DNA sequences were purchased from Eurofins Genomics and all PCR reactions were performed using Q5 High-Fidelity (New England Biolabs). Stable CRISPR KHNYN HeLa cells expressing CRISPR-resistant KHNYN-GFP ...
-
bioRxiv - Microbiology 2022Quote: ... The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The second PCR was performed using diluted PCR products ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Both the vector backbone and segregating lacZ promoter variants were PCR amplified using Phusion High-Fidelity DNA polymerase with HF buffer (New England Biolabs). For promoter PCR amplification ...
-
bioRxiv - Microbiology 2022Quote: ... We amplified the candidate sequences for the genes of interest with PCR using Phusion® High-Fidelity DNA polymerase (NEB) and primers designed for subsequent cloning (Table S4) ...
-
bioRxiv - Cell Biology 2022Quote: ... C39S and C50S were introduced with site-directed mutagenesis PCR with high fidelity Phusion DNA Polymerase (New England Biolabs, M0530) using primers described in Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sequences for entry modules were obtained via PCR-amplification of the target DNA sequence using primers that contain a ∼20bp overlap with the entry module using high-fidelity polymerase Q5 (NEB). For UM011_0103 ...
-
bioRxiv - Genetics 2022Quote: ... The promoter was then amplified from the construct prepared for the retrotransposition assay using Q5 High-Fidelity 2x Master Mix (New England Biolabs). Primers and annealing temperatures are listed in Supplemental Table 1 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... containing unique barcode to identify which region and time point DNA corresponded to were added to the linearized DNA by PCR amplification with Phusion High Fidelity polymerase (New England Biolabs) and HF buffer (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... P300core including NLS signal was amplified from pc-DNA-dCas9.P300core vector using Q5 High Fidelity 2x Master mix (Cat # M0492S NEB). Primer sequences are mentioned in supplementary Table 3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Single stranded gaps between hybridized oligonucleotides were then filled in by combining 5 µL of the hybridized oligonucleotides from the previous annealing step with 1 unit Q5 High Fidelity DNA polymerase (New England Biolabs), 1X Q5 Reaction Buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... The murJ locus in the gDNA of the SglPP7-resistant mutants was amplified by PCR using Phusion high-fidelity DNA polymerase (New England Biolabs) with the primers KC230 and KC234 ...
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Genomics 2019Quote: Enhancer and control regions (500-600 bp) were amplified from human genomic DNA from HEK293T cells using Q5 High-Fidelity Polymerase (NEB). Amplified fragments were cloned into pGL4.23 plasmid (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was diluted 1:1 with nuclease-free water and used in Q5® High-Fidelity DNA Polymerase (NEB) reactions (as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ng of the LMNB1 plasmid construct was subjected to a standard mutagenic PCR reaction with Q5 High Fidelity DNA polymerase (M0491, New England Biolabs) and 25 ng of specific primers ...
-
bioRxiv - Immunology 2019Quote: ... TCR amplification was achieved by performing two rounds of nested PCR using Phusion High-Fidelity PCR Master Mix (New England Biolabs). During the first PCR priming ...
-
bioRxiv - Bioengineering 2019Quote: ... the target region was PCR-amplified using primers Deep-F1/R1 with 25 cycles using Q5 High-Fidelity 2X Master Mix (NEB). Second ...
-
bioRxiv - Synthetic Biology 2019Quote: ... two oligonucleotides were designed with an overlap of 35 bp containing the T7 promoter sequence and amplified using Q5 High-Fidelity DNA polymerase (NEB) according to the suppliers instructions ...
-
bioRxiv - Immunology 2019Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplification of full-length cDNAs of CG33172 (clone MIP10235 in BDGP) was done using standard PCR techniques using Q5 high fidelity DNA Polymerase (New England BioLabs). Amplification products were cloned between the HindIII and NotI restriction sites of the pET-28a (Novagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...