Labshake search
Citations for New England Biolabs :
3501 - 3550 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The library of circular DNA fragments was then used as a PCR template with forward and reverse primers specific to the transposable element and amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs). PCR products were separated by electrophoresis on a 1% agarose gel and purified using the Zymoclean Gel DNA recovery Kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: The full-length badR gene was amplified from the genome DNA of the wild-type Borrelia using High-Fidelity Taq Polymerase Fusion (NEB). The fragment was subsequently ligated into the pMAL-c2X (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid backbones and inserts for cloning were amplified from the purified chromosomal DNA using Q5 High-Fidelity DNA Polymerase (NEB). PCR products and plasmids were purified with Monarch DNA kits (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... while all other fragments were amplified by PCR using the Q5 HotStart High-Fidelity 2X master mix (New England Biolabs). All plasmids were sequence-verified with Sanger sequencing (Macrogen Europe ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with primers 515F–806R targeting the V4 region of the 16S rRNA using Phusion High-Fidelity DNA Polymerase (NEB). The PCR product concentration was measured with Quant-iT PicoGreen dsDNA Assay Kits (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sgRNA containing sequences of the genomic template DNA were amplified by PCR using the indicated Primers of HPLC grade (S2) and Q5 Hot Start high-fidelity DNA polymerase (New England BioLabs). The PCR products of the toxin resistant cells and untreated library cells were analyzed by deep sequencing using an Illumina-based procedure via a commercial supplier (Eurofins Genomics).
-
bioRxiv - Molecular Biology 2023Quote: 5’ biotinylated DNA that was used for transcription antitermination assays and as a PCR template when preparing modified DNA templates below was PCR amplified from plasmid DNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and primers HP4_5bio.R and PRA1_NoMod.F (for ZTP and fluoride templates ...
-
bioRxiv - Plant Biology 2022Quote: ... The sgRNA expression cassettes of OsU6c–sgRNA–T1 and OsU3–sgRNA–T2 were amplified from pYLsgRNA–OsU6c and pYLsgRNA–OsU3 plasmids using Phusion High-Fidelity DNA Polymerase (New England BioLabs) and cloned into a binary vector ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of the resuspended pooled oligonucleotide library or NNK-based library was used as an initial reverse primer along with 0.5 μM AAV9_K449R_Forward primer in a 25 μL PCR amplification reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). 50 ng of a plasmid containing only AAV9 (K449R ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... both CRISPRi plasmid pools and genomic DNAs were PCR amplified with Miseq_Adaptor primers (Table S5) using Q5 High-Fidelity DNA Polymerase (NEB; M0491L). PCR samples were run on a 2% agarose gel and purified using a Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... and MATR3(S85C) from pGW1 FLAG-MATR3-EGFP constructs61 using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and flanking primers that eliminated linker sequences and EGFP ...
-
bioRxiv - Plant Biology 2022Quote: ... by PCR based site-directed mutagenesis (SDM) using non-overlapping primers listed in Supplementary Table S1 and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Subsequently ...
-
bioRxiv - Plant Biology 2022Quote: DNA constructs carrying mutations and various fusions were produced by overlapping PCR using a high-fidelity Taq Polymerase (Q5, New England Biolabs) followed by subcloning of gel-purified PCR fragments into a SfiI-digested pMB binary vector (Sager et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Tiled 1200 bp amplicons were generated using midnight primers (IDT) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) for 32 cycles (LA-GSU1 to LA-GSU19 ...
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Cancer Biology 2022Quote: ... The coding sequence of the human MPI gene was amplified by PCR using Phusion High-Fidelity DNA polymerase (M0530, New England BioLabs), a primer set (Supplementary Table S1) ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed on an Applied Biosystems Thermal Cycler using Q5 High-Fidelity 2X Master Mix (New England Biolabs, M0492S). PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: Desired sequences were amplified using two subsequent PCR reactions using the Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB). All extension steps were carried out in a 15s timeframe and the first PCR round consisted of 10 cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... And cloned into a expression plasmid under the control of the EF1α using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs). To generate 3’ and 5’ stop codon reporters ...
-
bioRxiv - Bioengineering 2024Quote: ... Digested backbone plasmid and annealed spacer sequences were assembled using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs) in a reaction containing 5 µl of the master mix 2 µl of the digested backbone and 3 µl of the PCR annealed spacer ...
-
bioRxiv - Bioengineering 2024Quote: ... All PCR amplifications were performed using the Q5® High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P52, P53) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the 3′utr + 50bp of bli-1 ...
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P35, P36) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the promoter region of bli-1 ...
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P45, P46) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the 3′utr + 50bp of unc-22 ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were immediately purified using a Qiagen minElute column and subjected to PCR amplification with NEBNext High-Fidelity 2X PCR Master Mix (NEB). Optimal PCR cycles were determined via qPCR to avoid over-amplification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and the GeneArt Gibson Assembly HiFi Master Mix (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the coding regions were amplified with primers listed in Supplementary file Table S1B from chromosomal DNA using Phusion high-fidelity DNA polymerase (NEB) and subjected to restriction enzyme digestion ...
-
bioRxiv - Microbiology 2024Quote: ... PCRs were done in a 50 µl mix for 30 cycles using Phusion High-Fidelity DNA polymerase (New England Biolabs). Purification of PCR products was routinely performed using the QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... an inverse PCR was performed using R3-p21 and the oligonucleotides ToANV-rectest-For/ToANV-rectest-Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... The final cDNA sample was then split into 16 separate reactions for final PCR amplification using 16 unique Illumina indexing primers and Q5 Hot Start High-Fidelity 2X Master Mix (NEB). After amplifications ...
-
bioRxiv - Neuroscience 2024Quote: ... and the codon-optimized APEX2-V5 sequence (see above) were amplified using the Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into the pJFRC81-10xUAS-IVS-Syn21-GFP-p10126 vector (Addgene #36432 ...
-
bioRxiv - Neuroscience 2024Quote: ... a ∼1500bp genomic sequence flanking the Ten-m start codon (∼750bp each side) was amplified using the Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into the pCR-Blunt-TOPO vector (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... and amplified the Gek or Syd1 coding sequences using the Q5 hot-start high-fidelity DNA polymerase (New England Biolabs). The verified coding sequences were then assembled into a modified pUAST-attB vector ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 ng cDNA was amplified by PCR for 30 cycles using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs) using the following primers:
-
bioRxiv - Genomics 2024Quote: ... and the wild-type (USH2A:c.7595-2144A) minigene plasmids were generated by Q5® High-Fidelity DNA Polymerase (New Englands Biolabs) amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... One microliter was used as DNA matrix to produce PCR amplicons with the Phusion High Fidelity Taq Polymerase (#M0530; NEB) and new primers (Salten-pb1-3183-F and Salten-pb1-4136-R ...
-
bioRxiv - Evolutionary Biology 2024Quote: Indexed libraries were generated using the standard Illumina two-step PCR protocol using Q5 high fidelity DNA polymerase (New England Biolabs). Paired-end sequencing with a 2×250 bp read length was performed at the Bio-Environment platform (University of Perpignan Via Domitia Perpignan ...
-
bioRxiv - Immunology 2024Quote: ... 1 µL of sample from an individual cDNA reaction was mixed with 12.5 µL of 2x Q5® High-Fidelity Master Mix (New England Biolabs), 0.5 µL of each primer (0.2 µM final concentration of each primer) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Microbiology 2024Quote: Plasmids were constructed by amplifying inserts by PCR using specific oligonucleotides and the Q5 high fidelity enzyme (New England Biolabs). PCRs were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2024Quote: ... Primers with overhanging sequences homologous to either 5’ or 3’ end of target gene fragments were used to linearize pMCSG53 expression vectors at the multiple cloning sites through PCR reactions (Q5 High-Fidelity 2X Master Mix, New England Biolabs). Amplicons were subsequently gel-extracted (Wizard SV Gel and PCR Clean-Up System ...
-
bioRxiv - Microbiology 2024Quote: ... The relevant regions were amplified by PCR using primers designed for this study and shown in Table S1 Q5 High Fidelity DNA polymerase (NEB) was used for sequence analysis with appropriate purity and accuracy.
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were generated by amplifying sgRNA sequences from genomic DNA using bar-coded Illumina-compatible adapter-containing primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). PCR products were pooled and purified with a ZymoSpin V column with Reservoir (Zymo Research) ...