Labshake search
Citations for New England Biolabs :
3151 - 3200 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The scFv Gibson Assembly reaction products were transformed into NEB Turbo high efficiency chemically competent cells (NEB Catalog# C2984I) and plated on LB + Ampicillin plates ...
-
bioRxiv - Microbiology 2023Quote: ... site-directed mutations were performed using the NEB Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs, M0493) with primers generated via the NEBaseChanger tool (https://nebasechanger.neb.com/ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Native PCC 11901 genetic parts were amplified from genomic DNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Where necessary ...
-
bioRxiv - Cancer Biology 2023Quote: ... The MR1 locus was amplified from the DNA using PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England BioLabs; Ipswich, MA, USA). SafeSeqS(52 ...
-
bioRxiv - Neuroscience 2023Quote: ... SadCas9-2xKRAB-p2a segment was amplified by PCR from backbone using high-fidelity polymerase (Phusion, NEB, Cat. No. M0530S); and TurboRFP was PCR amplified using high-fidelity polymerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... Re-joined ends were amplified by 35 cycles of PCR from 0.8 µl template using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and primers NOSprom-nested-F2 and TagRFP-nested-R2 (Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the product was purified using magnetic SPRI beads and amplified using 0.5 µM i5/i7 Illumina indexed primers in Q5 High-Fidelity Master Mix (NEB).
-
bioRxiv - Immunology 2023Quote: ... Amplicon containing U6 promoter and sgRNA4 was PCR amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530) and assembled into SalI linearized LentiGuide-GBP-Chr3 sgRNA3 plasmid using HiFi DNA Assembly Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were constructed and amplified using 1.25 μM Nextera index primers and NEBNext High-Fidelity 2xPCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Molecular Biology 2023Quote: Preparative PCR for plasmid construction were performed with Q5 High-Fidelity DNA Poly-merase (New England Biolabs cat. #M0491S) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The donor sequence for mScarlet and linker was PCR amplified from pmScarlet-i_C1 using Q5 High-Fidelity DNA polymerase (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... a 835bp region around the cut locus was amplified using the Q5 Hot Start High-Fidelity DNA Polymerase (NEB) and 400nM of each primer (Table S6 ...
-
bioRxiv - Bioengineering 2023Quote: ... 100 ng of the extracted gDNA were for PCR with the Q5 high-fidelity DNA polymerase (New England Biolabs). The product was analyzed via gel electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... End point PCR to detect expression of the transgene was performed using the Phusion high fidelity polymerase (#M0530L, NEB) protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... in accordance with the manufacturer’s instructions and target sites were amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs) to verify the endogenous KRAS sequences of single clones ...
-
bioRxiv - Genetics 2023Quote: ... 6.5 μL of cleaned-up DNA was used in each PCR1 amplification with Q5 High-Fidelity DNA Polymerase (NEB) for 15 cycles ...
-
bioRxiv - Genetics 2022Quote: ... The sequences of HS5 and NRE were PCR amplified from human genomic DNA using Phusion high fidelity polymerase (NEB). Hg38 genome coordinates and sequences of primers used ...
-
bioRxiv - Genomics 2023Quote: ... All PCR reactions were performed with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... MotA-ASR inserts and linear vector were prepared by PCR amplification using Q5 high-fidelity (HF) DNA polymerase (NEB). The PCR reaction recipe and condition is provided to supplementary information ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid inserts were amplified by PCR using the Q5® Hot-Start High-Fidelity 2X Master Mix (NEB). Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated and regions flanking Exon 5 were PCR-amplified using Q5 High-Fidelity DNA Polymerase (NEB) (oligonucleotide primers F ...
-
bioRxiv - Genetics 2023Quote: ... The target loci were PCR amplified in 30 PCR cycles using Q5 High-Fidelity DNA Polymerase (New England Biolabs), locus-specific primer pairs (Supplementary Information ...
-
bioRxiv - Biochemistry 2023Quote: ... Specific primers (cDNA_CDIN1_Fw ATGATACTGACCAAAGCTCAGTAC and cDNA_CDIN1_Rv TCAAGCTATGCTGTGGCATAA) were designed to amplify CDIN1 coding sequence using proofreading Q5 High-Fidelity DNA Polymerase (New England Biolabs). The PCR product was purified by GenElute PCR Clean-Up Kit (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA oligonucleotides were amplified using Phusion® High-Fidelity PCR Master Mix with HF Buffer (M0531L, New England BioLabs). AmpliScribe™ T7-Flash™ Transcription Kit (ASF3507 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... The reactions were performed in triplicate for 14 cycles using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), pooled and purified using AMPure XP beads (Beckman Coulter).
-
bioRxiv - Neuroscience 2023Quote: ... NaV1.6A or NaV1.6N using PCR mutagenesis with Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) as described previously (22) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Genomics 2023Quote: ... ATAC-seq libraries were prepared by ∼8 cycles of PCR using NEBNext High Fidelity 2X PCR Master Mix (NEB) and primers containing Illumina barcodes (Buenrostro et al ...
-
bioRxiv - Genomics 2023Quote: ... Accessible DNA libraries were amplified by PCR using NEBNext High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), custom Nextera PCR primers as previously described (29) ...
-
bioRxiv - Genomics 2023Quote: ... The number of library amplification cycles was determined by qPCR analysis using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) on LightCycler® 96 System (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two pairs of primers were used to perform PCR amplification with Q5 High-Fidelity 2X Master Mix (NEB, #M0492S). All validation primers are listed in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 16 reactions were carried out per amplicon per cell line using Q5 High-Fidelity 2x master mix (NEB, #M0492L) with primers containing partial Illumina adapters ...
-
bioRxiv - Microbiology 2023Quote: ... palustris RCB100 was used as a template for PCR amplification using Phusion High-Fidelity DNA polymerase(New England Biolabs) with primers aliAF and badKR (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Artificial mutations were introduced in the minigene by Reverse Site-Directed Mutagenesis with Phusion High-Fidelity DNA Polymerase (NEB), followed by 5’ phosphorylation with T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... cDNA was PCR amplified using the NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with the following forward and reverse primers ...
-
bioRxiv - Genomics 2024Quote: ... Tagmented DNA was PCR amplified using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs, Cat. No. M0541) with indexed primers (CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNGTCTCGTGGGCTCGG and AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Biochemistry 2024Quote: ... OSCA1.2 pIRES2-mCherry vector and the BLD of OSCA3.1 were separately amplified by PCR using Q5 High-Fidelity 2X Master Mix (NEB), followed by fragment assembly using Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used for tagmentation and amplified with Nextera Ad1_noMX and Ad2.X primers (Supplementary Table 5) using 2x Phusion high-fidelity PCR mix (NEB). AMPure beads (Beckman coulter ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were constructed by PCR with Illumina P5 and P7 primers using Q5 High-Fidelity DNA Polymerase (#M0491L, NEB), and purified with 1.5x AMPure XP beads ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Microbiology 2024Quote: ... the promoter regions of dotA (490 bp upstream dotA_RS21140 and dotDCB (intergenic region of 921 bp between dotD_RS21055 and RS21050 genes) were PCR-amplified using a high-fidelity polymerase (Phusion, NEB) and PCR products were purified before cloning (QIAquick PCR purification kit ...
-
bioRxiv - Microbiology 2024Quote: ... Both PCR reactions used 0.02U/L Q5 Hot Start high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA) with 200M dNTPs and 0.5M forward and reverse primers in 1M Q5 reaction buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was poly(A)-selected using the NEBNext® High Input Poly(A) mRNA Isolation Module (NEB, E3370S). The final elution step of this protocol was performed using RNase-free ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 rounds of PCR were run using Q5® Hot Start High-Fidelity 2X Master Mix (NEB cat #M0494) following the manufacturer’s instructions with a 63°C annealing temperature and 30s extension ...
-
bioRxiv - Cancer Biology 2019Quote: ... 948 μL of ligation master mix was then added: 150 μL of 10× NEB T4 DNA ligase buffer with 10 mM ATP (NEB, B0202), 125 μL of 10% Triton X-100 ...
-
bioRxiv - Genomics 2019Quote: ... 948 µL of ligation master mix was then added: 150 µL of 10× NEB T4 DNA ligase buffer with 10 mM ATP (NEB, B0202), 125 µL of 10% Triton X-100 ...