Labshake search
Citations for New England Biolabs :
3301 - 3350 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... ∼2000 bp of genomic sequence flanking the targeted insertion site was amplified by Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into pCR-Blunt-TOPO vectors (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’ homologous arm was amplified through overlap extension: Fragment 1 was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs) with primers- clk-5’-Fragment1-F and clk-5’-Fragment1-R (listed in Supplementary Table 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... the 5’-homology arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ homozygous arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed in 20 uL 1X Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB M0531) and using touchdown PCR cycling at 98°C for 30s ...
-
bioRxiv - Genomics 2021Quote: ... approximately 2.5 µg of high molecular weight DNA was repaired using the NEBNext FFPE Repair Mix (NEB, Ipswich, Ma, USA) for 15 min at 20°C before purification with Ampure XP beads ...
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 μl of diluted cDNA was used as template using the indicated primers in a 50 μl reaction using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs). 15 μl of amplified DNA was used for EcoRI and BmrI restriction enzyme digestion (New England Biolabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Neuroscience 2020Quote: ... The randomization of LCDR3 and HCDR2 was performed by two PCR steps using Phusion High Fidelity DNA polymerase (NEB Biolabs). A first randomization PCR was performed using randomized primers (a forward primer to randomize LCDR3 and a reverse primer to randomize HCDR2) ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were constructed and amplified using 1.25 μ Nextera index primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: Deep mutational scanning libraries were generated using degenerate primers to amplify TRIM5α-HA in pQCXIP using high-fidelity Q5 polymerase (NEB). Degenerate primers contained a single NNS codon (N = A/T/C/G ...
-
bioRxiv - Biochemistry 2021Quote: ... either to aspartate (2D) or alanine (2A) were generated by site-directed mutagenesis using Q5 high fidelity DNA polymerase (NEB) using primers containing the mutations S409D/410D and S409A/410A and pJ4M TDP-43-TEV-MBP-His6 vector as a template ...
-
bioRxiv - Biochemistry 2021Quote: ... The floated fraction corresponding to a mixture of high- and low-density EVs (42) was treated with MNase (NEB, M0247S) to degrade any nucleic acid not contained within the EVs and deactivated with 25 mM ethylene glycol-bis(β-aminoethyl either)-N,N,N′,N′-tetraacetic acid (EGTA ...
-
bioRxiv - Plant Biology 2020Quote: ... The full-length SpG was assembled using the overlapping-extension PCR-based method with the high-fidelity DNA polymerase Phusion (NEB) and the primers listed in Table S3 ...
-
bioRxiv - Systems Biology 2020Quote: ... Appropriate restriction sites were either included in custom synthesized oligonucleotides (IDT) or introduced by PCR with Q5 High-Fidelity Polymerase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutation of Cys324 to alanine was achieved by site directed mutagenesis by inverse PCR using Q5 high fidelity DNA polymerase (New England, BioLabs), pET28-PnpA as template and primers (5’-GCCTCTGGTTTATTAAAAAGGTTATTCAGC-’3 and 5’-ATCATTATTGAAATCCATTCCCCC-’3) ...
-
bioRxiv - Neuroscience 2020Quote: ... and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB) and primers (GAATTC(EcoRI)/GAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCC and GGATCC(BamHI)/AGCTTTAATAGTGTGCAGGGTCAGTCAG) ...
-
bioRxiv - Plant Biology 2020Quote: Coding sequences and promoters were amplified from complementary cDNA or genomic DNA templates respectively using the Phusion High Fidelity DNA-polymerase (New England Biolabs). RAP2.121-28-LUC and ZPR2-LUC gene fusions were obtained by overlapping PCR ...
-
bioRxiv - Microbiology 2020Quote: ... After bead purification half of the DNA elute was used for a 50-µl PCR reaction containing the NEBNext High-Fidelity 2x Master Mix (NEB), 25 pmol ...
-
bioRxiv - Plant Biology 2020Quote: The cDNA encoding the full length AtHMA4 protein or the cDNA encoding the 473 amino acid AtHMA4 C-terminal domain was amplified from previously generated AtHMA4 cDNA plasmids (Mills et al., 2010) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs). The primers AtHMA4FL-F (5′-ACTGGATCCCTCTCAACCTTTATCTGAT-3′ ...
-
bioRxiv - Plant Biology 2020Quote: ... or PCR-amplification of the target DNA sequence using primers that contain a ~20bp overlap with the entry module using high-fidelity polymerase Q5 (NEB) or GXL (Takara Bio) ...
-
bioRxiv - Systems Biology 2021Quote: ... We then amplified barcodes from cDNA using primers CPL2 and CPL7 (Supplemental Table S7) with the Q5 High Fidelity 2X Master Mix (New England Biolabs). We performed 4 PCRs per replicate from cDNA ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed 4 PCRs per pool from cDNA and gDNA respectively using the Q5 High Fidelity 2X Master Mix (New England Biolabs), then pooled the PCRs and purified them ...
-
bioRxiv - Systems Biology 2021Quote: ... The barcodes were then amplified from the cDNA and genomic DNA (gDNA) using the Q5 High Fidelity 2X Master Mix (New England Biolabs) with primers specific to our reporter gene (CPL1-2 ...
-
bioRxiv - Microbiology 2020Quote: ... the high fidelity Phusion Hot Start Flex DNA polymerase enzyme and 5X Phusion HF buffer (New England Biolabs, UK, M0535) were used according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: The coding sequences of PCR products were amplified by Q5 High-Fidelity DNA Polymerase and introduced to pFNLucG or pFCLucH by Gibson Assembly (New England Biolabs) (Kim ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... SPL8 and SPL15 were amplified from cDNA to generate the respective tagged constructs using Q5 high fidelity DNA polymerase (NEB). The primers (listed in Table 5 ...
-
bioRxiv - Plant Biology 2021Quote: ... the 560 bp region upstream of the transcription start site was amplified using Q5 high fidelity DNA polymerase (NEB, England) and ligated into EcoRV digested SK+ cloning vector ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... Regions of 16S rDNA gene were amplified by PCR from extracted DNA with the Q5 high-fidelity DNA polymerase (New England BioLabs) using the universal primers 926F ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin cassette bookended with FRT sites from plasmid pKD4 with 60-bp homology to the upstream and downstream region of mgrB was PCR amplified using high fidelity Q5 polymerase (New England BioLabs [NEB]). The purified PCR product was then electroporated into the target strain (AZ63 ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Genomics 2021Quote: ... and used to prepare libraries using the Nextera XT Dual-Indexed primer system (Nextera) and NEBNext High-Fidelity PCR Master Mix (New England Biolabs). Libraries were sequenced by the UCSD Institute for Genomic Medicine on an Illumina HiSeq 4000 using paired end reads of 100bp.
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified using primers that contained restriction sites for EcoRI and SacI (Table S5, primers No. 1-6) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Microbiology 2021Quote: ... DNA amplicons for HA and PA gene segments with partial sequencing adapters were generated via PCR amplification of cDNA using the Phusion High-Fidelity DNA Polymerase (New England BioLabs) and gene segment specific primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2021Quote: Serial dilutions of dsDNA (porA, A2059G, C2611T) were prepared by using Q5 High-Fidelity DNA Polymerases (New England Biolabs; M0492S) to amplify the target gene in a total reaction volume of 50 μL (25 μL of 2× Master Mix ...
-
bioRxiv - Molecular Biology 2020Quote: PCR was carried out with TIDE or amplicon sequencing primers as shown in the Supplementary Table using High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using the DNA Clean & Concentrator-100 (Zymo ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tyr80Phe mutation was added to eLACCO1 to tune the lactate affinity using Q5 high-fidelity DNA polymerase (New England Biolabs). The resulting mutant was designated as eLACCO1.1.
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... Deletion of the residues 561-625 (ΔNES) was done by deletion PCR using Phusion® High-Fidelity DNA Polymerase (NEB), followed by DpnI digestion of the template and transformation into bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 μL purified total cDNA (100-200 ng) was used to amplify target genes through high-fidelity PCR (Q5, New England Biolabs). A vector backbone fragment was obtained by PCR amplification from plasmid pcDNA3.1/zeo(+ ...
-
bioRxiv - Immunology 2022Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Biophysics 2022Quote: Saturation mutagenesis of mEosEM at His63 was performed in the pEGFP-N1-mito-mEosEM plasmid with Q5 high fidelity polymerase (New England Biolabs). The amplified fragments containing homologous arms and mutation sites were transformed into the Top10 competent cells (Tsingke ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng DNA was used as input in a first round of PCR (25–27 cycles, Q5 hot start high-fidelity DNA polymerase, New England Biolabs) to amplify the genomic loci of interest and attach common overhangs ...
-
bioRxiv - Biochemistry 2022Quote: ... Genomic ecDHFR was amplified (forward: CCAAGTACGCCCCCTATTGA reverse: ATATCTCGAGTGCGGCCGCGTTATGCGTAGTCTGGTACGTCG) and purified from the gDNA template using Q5 High-Fidelity DNA Polymerase (NEB) and QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... the EcoRI to KpnI fragment was subcloned to a temporary plasmid and PCR amplified with Q5 high fidelity DNA polymerase (NEB) using the dCore-BamHI-FW (5’-TTT CTG GAT CCT TGC TGG CCC TGC TGT CCT GCA TC-3’ ...