Labshake search
Citations for New England Biolabs :
3401 - 3450 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The T7-gRNA forward primer and the reverse scaffold primer were used in primer extension reaction to synthesized a double stranded DNA fragment by using Q5 High Fidelity-based PCR (New England Biolabs) followed by PCR purification (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... The Vluc sequence from CSCW2-Vluc-IRES-mCherry was amplified by Q5 High-Fidelity DNA Polymerase (M0491S, New England BioLabs) using primers containing a T2A peptide sequence ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All DNA fragments of the genes were amplified by PCR with Phusion® High Fidelity Polymerase (New England Biolabs, USA) and inserted into the vector pCAMBIA330035Su by USER cloning (Nour-Eldin et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Linear DNA templates for in vitro transcription were generated from pNB1u or pOO2-GW plasmid by PCR using Phusion High-Fidelity DNA Polymerase (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The ade2::TdFBA1 locus from each transformant was amplified by PCR with a high-fidelity polymerase (New England Biolabs, M0492S) and Sanger sequenced ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR amplification was performed in an Eppendorf 2720 Thermal Cycler with either Q5 High-Fidelity DNA Polymerase (New England Biolabs) or GoTaq DNA polymerases (Progema ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The targeted genomic locus was then PCR amplified with primers flanking the expected cutting site (Supplementary Table 3) using Q5 Hot Start High-Fidelity Polymerase (NEB). 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR amplifications were carried out using a DNA polymerase (Phusion High-Fidelity DNA Polymerase; New England Biolabs, Hitchin, UK). The DNA fragments were then purified with a NucleoSpin Gel and PCR Clean-Up Kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using ARTIC network V3 tiled amplicon primers in two separate reactions by Q5 High-fidelity polymerase (NEB). First-round PCR products were purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2021Quote: ... primers that contained restriction sites for BamHI and XmaI or XbaI (Table S5, primers No. 9-16 and 95-98) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Microbiology 2021Quote: ... Roughly 1/10 of the resulting volume was used as template for a two-step PCR amplification with Phusion High-Fidelity DNA Polymerase (New England Biolabs) per the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1 μl of each PCR reaction was amplified with index-containing primers to reconstitute the TruSeq adaptors using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Cancer Biology 2019Quote: ... desired protospacer and a truncated constant region of the tracrRNA were annealed and amplified with Phusion high-fidelity DNA polymerase (New England Biolabs) to produce the chimeric sgRNA template for transcription ...
-
bioRxiv - Biochemistry 2021Quote: ... primers used are listed in Supplementary Table 5 and PCR was performed by standard procedures using Phusion high fidelity DNA polymerase (NEB). Gene deletion of sll1951 was performed by amplifying an upstream 966bp fragment in the N-terminal region of sll1951 using primers Sll1951leftfor and Sll1951leftrev and a 954bp downstream fragment in the N-terminal region of sll1951 using primers Sll1951rightfor and Sll1951rightrev ...
-
bioRxiv - Synthetic Biology 2020Quote: ... marxianus strain CBS6556 (Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands) using Q5 High-Fidelity Polymerase (M4092L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... marxianus strain CBS6556 (Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands) using Q5 High-Fidelity Polymerase (M4092L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2021Quote: ... The anchor sequence was added to the 5’ end of the transcript by PCR amplification using the gene-specific reverse primer PK13 and the oligo(dT)-anchor primer and Phusion High-Fidelity DNA Polymerase (New England Biolabs). PCR products were analysed on agarose gels and purified using the QIAquick PCR purification Kit according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... PIK3C2B intron 10 fragment was amplified from the control hPSC genomic DNA and NFIA ORF was amplified from the control hNP cDNA using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). PIK3C2B intron 10 fragment was cloned into NanoLuc luciferase reporter construct (pNL3.2[NlucP/minP] ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Genomics 2019Quote: ... and we used 10ng of the reporter plasmid containing the reference allele as a template in site-directed mutagenesis using Q5 Hot Start High-Fidelity master mix (New England Biolabs). 4uL of the SMD PCR product was treated with KLD mix (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Microbiology 2019Quote: ... Tubes were centrifuged at 8000 xg for 30 sec and supernatants were used for 16S rRNA gene PCR amplification with Phusion High-Fidelity DNA Polymerase (New England Biolabs) in a 20 μL reaction according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... a multiplex tiling PCR was attempted using the previously published YFV primer scheme and 30 cycles of PCR using Q5 High-Fidelity DNA polymerase (NEB) as previously described (20) ...
-
bioRxiv - Genetics 2020Quote: ... for 1 hour at 60°C and the lysate was then used as a template for PCR with Q5 Hot Start High-Fidelity DNA Polymerase (NEB). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genetics 2021Quote: ... To assess library composition by deep-sequencing a PCR reaction was carried out to add illumina adaptors by using the Phusion High Fidelity DNA Polymerase (NEB), with an annealing temperature of 60°C and 14 cycles (OG125/OG126) ...
-
bioRxiv - Genetics 2020Quote: ... The 307 bp 3’UTR was then amplified from the same WT adult genomic DNA by PCR using Phusion High Fidelity Master Mix (NEB) and primers ...
-
bioRxiv - Genetics 2020Quote: ... All gene amplification reactions were performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs). To analyze the non-drive allele ...
-
bioRxiv - Genetics 2020Quote: ... was PCR-amplified with the LHAdGao23fw and LHAdGao23rev primers from genomic DNA using Phusion High-Fidelity DNA Polymerase (New England Biolabs), producing 1060bp PCR product ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Combinations of indexed Ion Torrent primers were used to amplify barcodes in the library for each time-point (Figure S5 D) using Phusion High-Fidelity PCR (New England BioLabs). To avoid sampling bias during PCR amplification ...
-
bioRxiv - Genetics 2021Quote: ... We then PCR amplified enhancers and promoters separately from the same array using Q5 high-fidelity DNA polymerase (NEB M0492). We amplified enhancers in four 50uL PCR reactions (98°C for 30 seconds ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons were generated using genomic DNA extracted from plants of the respective line as template with Q5 High-Fidelity DNA polymerase (NEB) following supplier’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... RLuc coding sequence flanked by AgeI and PmeI restriction sites was amplified from the vector pFK i389 JcR2a dg (73) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs) using the following primers ...
-
bioRxiv - Cell Biology 2021Quote: To generate inducible vectors for MST2 wild type and del EDG we amplified the Flag2x _Strep2x fused to the MST2 constructs (wild type and del_EDG) with Q5 High-Fidelity Polymerase (New England BioLabs, # M0492) using specific primers (EcoRI_Flag_Fw and MST2_AgeI_Rv ...
-
bioRxiv - Developmental Biology 2020Quote: ... and specific primers containing BstbI and XhoI restriction enzyme sites were used with Q5 high-fidelity DNA polymerase (New England Biolabs). The resulting amplicons were cut using BstbI and XhoI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then assembled into blocks by applying the polymerase cycling assembly (PCA) method using Q5 High-Fidelity DNA Polymerase (M0491L/NEB) and cloned into an accepting vector for Sanger sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were carried out in 25ul volume with Q5® Hot Start High-Fidelity 2Χ Master Mix (NEB, USA), according to the routine PCR procedure of Q5 ...
-
bioRxiv - Cell Biology 2020Quote: ... the TAP coding sequence was PCR-amplified from chromosomal DNA from a strain expressing Heh2-TAP (SBCPL42, Dharmacon yeast resources) using Phusion High fidelity DNA polymerase (New England BioLabs) and cloned into the PacI and AscI sites of pFA6a-his3MX6 and pFA6a-TRP1.
-
bioRxiv - Cell Biology 2021Quote: Site-directed mutagenesis of pLenti-CMV-Neo-PINK1 (C125G)-EYFP or pLVX-puro-OMA1 (E328Q)-EYFP was performed by PCR amplification (CloneAmp HiFi PCR Premix, Takara or Q5 High-Fidelity DNA Polymerase system, NEB) of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system ...
-
bioRxiv - Genetics 2021Quote: ... A second PCR fragment from 24 bp upstream of the GFP start codon to NUP2 (+2482) was generated using the high-fidelity polymerase Phusion (New England Biolabs). The two fragments were joined by overlap extension PCR (Horton 1989 ...