Labshake search
Citations for New England Biolabs :
3201 - 3250 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... After adding 10% 1M sodium dodecyl sulphate (SDS) and 10 μL of 8 U/mL proteinase K (NEB, #P8107S, Ipswich, MA), the suspension was then incubated at 56°C for 4 hours ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products or annealed oligonucleotides were prepared as described above and end-labeled with 10 μCi [γ-32P]ATP (Perkin-Elmer) and 10 U T4 polynucleotide kinase according to established protocols (New England BioLabs). Binding reactions included 1 μl (~30 ng ...
-
bioRxiv - Genomics 2019Quote: ... Sonicated DNA was next incubated for 30 min at 20°C with 20 μl 10× end-repair buffer and 10 μl end-repair mix (NEB E6050S). The reaction was next cleared by 2× AmpureXP beads (Agencourt AMPure XP ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μmol of oligo DNA primer was incubated with 10 μCuries of [γ-32P]ATP and 10 U of T4 PNK (New England Biolabs) in 70 mM Tris-HCl (pH 7.6 ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Microbiology 2024Quote: ... 100 pmol oligonucleotide was incubated with 10 µCi [γ-32P]-ATP in the presence of 10 U T4 polynucleotide kinase (NEB) at 37°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: Plasmid pRS303 CBP-TEV-halo-orc3 gal1-10 orc4 was generated by cloning the CBP-TEV-halo sequence from plasmid pRS306-CBP-TEV-halo-Pri1-Gal1-10 Pri2 into plasmid pRS303-orc3-Gal1-10 orc4 through Gibson assembly (NEB #E2611L) using primers TL-446 ...
-
bioRxiv - Plant Biology 2023Quote: ... Type-IIS cloning was performed as described previously (Cai et al., 2020) using a Master Mix containing 10% (v/v) 10× T4 DNA ligase buffer (NEB #M0202), 2.5% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... Ligation was performed by addition to the sample of Ligation master mix (2007 μl of water, 300 μl of 10% Triton X-100, 18 μl of 10 mg/ml BSA (NEB, B9000S), 360 μl 10x T4 DNA ligase buffer (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Monarch kit (NEB) extracted and 0.1 pmol of each DNA fragment was CPER amplified in a 50 µL reaction containing 200 µM of dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Immulon 2HB 96-well plates were coated with 50 ng/well of Streptavidin (NEB, #N7021S) in 0.1 M NaHCO3 ...
-
bioRxiv - Biochemistry 2023Quote: ... plates that contain unc-104(R551H) allele was selected by genomic PCR and BamHI (NEB) digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... plates that contain unc-104(Q94L) allele was selected by genomic PCR and BamHI (NEB) digestion ...
-
bioRxiv - Plant Biology 2020Quote: ... APE1 gene with an additional 1500 bp on the 5’ side and 500 bp on the 3’ side was amplified by PCR using Q5 High-Fidelity DNA Polymerase (NEB) using primers 5’-TTATAATACCCACCCGTCAAAGCTGTG-3’ and 5’-TTATAACAGACTCATCCGGACCCCAA-3’ containing an additional PsiI restriction site (70°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... A region around an A-to-I editing site in BPNT1 was amplified by Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and the primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... by amplification of fragments using Q5 Hot Start High-Fidelity Master Mix and ligation using a Gibson Assembly Master Mix (New England Biolabs). pLKO.1-puro plasmids encoding scrambled shRNA and five FYCO1-targeted shRNAs were purchased from Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs) to introduce the GGG to GCT change that leads to a glycine to alanine (G120A ...
-
bioRxiv - Cell Biology 2020Quote: ... 1μl of each lysate was used as a PCR template to amplify 600-800 bp fragments around the edited E-box using the Q5 High-Fidelity 2X Master Mix (NEB). The resulting PCR products were purified in 96-well plates using the AmpliClean DNA Cleanup Kit (Nimagen ...
-
bioRxiv - Cell Biology 2020Quote: ... All other plasmids were constructed using classical subcloning or Gibson assembly using Hot Start High Fidelity Q5 polymerase from NEB. All constructs generated and used in this study were verified with sequencing of the coding region of the plasmids.
-
bioRxiv - Cell Biology 2020Quote: ... Qualitative PCR was set up in 200 μl PCR-SoftTubes (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Frankfurt am Main ...
-
bioRxiv - Immunology 2021Quote: ... The template for in vitro transcription was a PCR amplicon from the pLMCT-RBD-6His produced using the PHUSION high fidelity DNA polymerase (NEB) and TGTGGAATTGTGAGCGGATA as forward primer and CTTCACTATTGTCGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA as reverse primer.
-
bioRxiv - Cell Biology 2020Quote: ... R1/R2 purified fragments were split in 12× 25 μl-reaction PCR reactions with Q5 High-Fidelity 2X Master Mix (New England Biolabs), and NEBNext® Multiplex Oligos for Illumina® ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Full length Runx2 was amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA, USA) and cloned using CloneJET PCR Cloning Kit (K1231 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and GFPmut2) and segregating promoter variants were PCR amplified using Phusion High-Fidelity DNA polymerase with HF buffer (New England Biolabs). For promoter PCR amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... sequence was subcloned into pT7-gRNA vector and gRNA was synthesized using HiScribeTM T7 Quick High Yield RNA Synthesis (New England Biolabs). The pCS2-nCas9n was linearized using NotI and Cas9 mRNA was synthesized using mMESSAGE mMACHINE SP6 Kit (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... 0.8 μM sequencing index primer and Q5 high-fidelity 1x master mix (New England Biolabs, Ipswich, MA, Cat. No. M0492) were added to perform PCR amplification ...
-
bioRxiv - Biophysics 2022Quote: ... Oct4 was cloned into the pOPIN expression vector using the SLIC method and Phusion Flash High-Fidelity PCR Master Mix (Finnzymes/New England Biolabs). SLIC reactions were then transformed into One Shot™ OmniMAC™ 2 T1® Chemically Competent E ...
-
bioRxiv - Molecular Biology 2022Quote: The coding sequence of the BTB domain of selected ZBTB family proteins was amplified from cDNA derived from the human HCT116 cell line using Q5 High-Fidelity DNA Polymerase (NEB). Specifically for the Patz1 construct ...
-
bioRxiv - Physiology 2022Quote: ... All mutations were carried out using Q5 High-Fidelity 2X Master Mix from New England Biolabs (NEB, Ottawa, ON, Canada) and verified by sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... and amplicons were generated by PCR (primers 341F and 806R) using a Phusion High-Fidelity PCR Master Mix (New England Biolabs). Amplification product quality was assessed by gel electrophoreses and samples were pooled in equimolar ratios ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR amplified for 13 cycles with Illumina Nextera adapter primers using the NEBNext High Fidelity 2X Master Mix (NEB) with the following PCR program ...
-
bioRxiv - Neuroscience 2021Quote: ... a ∼2000-bp genomic DNA flanking the stop codon was amplified using Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into pCR-Blunt-TOPO vector (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplification of predicted full length CDSs (Pandey et al., 2016) were done using Q5® High-Fidelity DNA polymerase (NEB) and gene-specific primers (Supplementary Table S3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplification of libraries was performed with Q5 High-Fidelity DNA Polymerase in 25 μL according to the manufacturer instructions (New England BioLabs, NEB) with 10 cycles of amplification.
-
bioRxiv - Molecular Biology 2021Quote: ... resistance as well as a replication origin p15A (oriE) was PCR amplified by using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with primers pACshtl-for (5’-TTCACGCGTAGCACCAGGCG ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Biophysics 2022Quote: ... One µl of each plasmid at ∼1.5 ng/µl concentration were used as template and the reactions were carried out with Q5 High-Fidelity DNA Polymerase (New England Biolabs). PCR products were gel purified and successful mutagenesis was confirmed by sequencing (Macrogen) ...
-
bioRxiv - Biophysics 2022Quote: ClpA pore-2 mutations were introduced using round-the-horn mutagenesis with T4 polynucleotide kinase and Q5 high-fidelity polymerase (New England Biolabs) into pET9a-M169TClpA ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The gRNA was ordered as a single stranded oligo gblock from IDT and amplified using 2 50 uL reactions of Q5 High Fidelity 2X Master Mix (NEB). Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138 ...
-
bioRxiv - Genomics 2020Quote: ... 5’-AATTTCTACTAAGTGTAGAT-3’ for LbCas12a) were annealed to the bottom strand and extended by Q5 High-Fidelity DNA polymerase (NEB). IVT of the dsDNA products was performed with the HiScribe T7 Quick High Yield RNA Synthesis kit (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Sequence-independent PCR amplification was conducted with 5 μl of purified dsDNA obtained after Klenow reaction in 50 μl of final reaction which contained 1x Q5 High-Fidelity Master Mix (NEB), 2.5 μl of 10 μM primer K (5’-GACCATCTAGCGACCTCCAC-3’ ...
-
bioRxiv - Genomics 2020Quote: ... 2.5uL reverse PCR primer (CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT) and 25uL NEBnext High-Fidelity 2x PCR Master Mix (New England Biolabs, MA, United States)) using thermo-cycler conditions described in 94 for a total of 9 cycles ...