Labshake search
Citations for New England Biolabs :
3551 - 3600 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... And cloned into a expression plasmid under the control of the EF1α using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs). To generate 3’ and 5’ stop codon reporters ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and the GeneArt Gibson Assembly HiFi Master Mix (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were immediately purified using a Qiagen minElute column and subjected to PCR amplification with NEBNext High-Fidelity 2X PCR Master Mix (NEB). Optimal PCR cycles were determined via qPCR to avoid over-amplification ...
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P52, P53) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the 3′utr + 50bp of bli-1 ...
-
bioRxiv - Genetics 2024Quote: ... Cas9, a homology repair template that was amplified using sequences (P35, P36) (Phusion High-Fidelity DNA Polymerase, New England BioLabs), which amplifies the promoter region of bli-1 ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Genetics 2023Quote: ... 1 ng of oligoarray library DNA was PCR amplified for 12 cycles in 40 μL reactions using Q5 High-Fidelity DNA Polymerase (NEB) and primers specific to the right or left end library ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Microbiology 2023Quote: The RmlC expression constructs used in this study were constructed by PCR amplification of the rmlC alleles from strains MG1655 (rmlCWT) and BP27 (rmlCL122W) using the Q5 high-fidelity polymerase (NEB) and oligos listed in Table s1 and subsequent insertion into pBAD18-Chl via restriction digestion cloning.
-
bioRxiv - Developmental Biology 2023Quote: ... 25 uL of 2xphusion PCR mastermix (Phusion High-Fidelity PCR Master Mix with HF Buffer – 100 rxns, NEB, cat #M0531S), 0.625uL of 100uM F primer ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was then amplified using nested PCR (Primers in Table S3) with High-Fidelity Phusion or Q5 DNA polymerase (New England Biolabs), and the PCR products ligated into pGEM®-T Easy vector (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-102-syn and S129A-syn) were created within this pcDNA vector by site directed mutagenesis using Phusion High-Fidelity DNA Polymerase (New England Biolabs)1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Microbiology 2022Quote: ... double stranded library was amplified using PCR by adding 30 μL of 2X Q5 High Fidelity Master Mix (NEB M0492L), 0.4 μL of 100 μM oDS028 ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from individual embryos by heat shock denaturation in 50 mM NaOH (95°C for 20 minutes) and used for PCR by using Q5 High-Fidelity Taq Polymerase (New England Biolabs). The presence of specific amplicons was tested by running the PCR product on 1% agarose gel ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the DNA fragments were PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs Inc) following manufacturer instructions and the PCR reactions were purified using PureLink™ PCR Purification Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... A region containing the putative promoter region of the fhuD1/spm operon was amplified by Phusion High-Fidelity DNA polymerase (New England BioLabs) with the primers listed in Table S2 ...
-
bioRxiv - Synthetic Biology 2023Quote: Primers (Table S1) were ordered from Integrated DNA Technologies (IDT) and constructs were PCR-amplified with Q5 High Fidelity polymerase (NEB). For all vectors ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Genomics 2023Quote: ... 10µL of transposed DNA was amplified in a 50µL PCR reaction using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541S) for 5 cycles after a 5 min elongation step ...
-
bioRxiv - Developmental Biology 2023Quote: Five PCR reactions of 50 μl PCR mixture were made and amplified using Q5 High-Fidelity DNA polymerase (M0491; NEB). Next ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA was amplified by performing a multiplexed PCR in two pools using the ARTIC-N6 primers and the Q5 High-Fidelity DNA polymerase or Q5 Hot Start DNA polymerase (New England BioLabs). The DNA libraries for Illumina NGS were prepared from pooled amplicons by using a QIAseq FX DNA Library Kit (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... full length coding sequences were amplified from human cell line cDNA with AttB overhangs using Phusion High-Fidelity DNA polymerase (M0530S, New England BioLabs) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 50 µl PCR reactions were performed for each timepoint using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with 20 to 50ng of template isolated plasmid DNA ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG) and the Phusion High-Fidelity DNA polymerase (New England Biolabs). The XBB.1.5(-G252V ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Sequencing samples were amplified by qPCR for 20 cycles or less and between 600 and 800 relative fluorescence units using Q5 High-Fidelity DNA Polymerase 2X Master Mix (New England Biolabs) to minimize replication errors ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Cell Biology 2023Quote: ... The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs). The pCAG-EGxxFP plasmid (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and gBlocks were digested with NEB CutSmart buffer (Cat# B72045) using restriction enzymes Nco1-HF (high fidelity Cat# R3193S) and Xho1-Cat# R0146S both from NEB. DNA was run on 2% agarose gel and extracted using QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Bioengineering 2023Quote: Double-stranded linear DNA template for HDR and electroporation was amplified from plasmid DNA by PCR using Q5 High-Fidelity Master Mix (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... the region containing the target surrounded by the context was amplified by PCR using primers P7-P8 with Q5 Hot Start High-Fidelity 2× Master Mix (NEB) with the following conditions ...
-
bioRxiv - Genetics 2023Quote: ... A second primer was then added and a complementary mutated bottom strand synthesised using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) and Taq DNA ligase ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ligated dsDNA products were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) with 200 nM of Illumina multiplex and index barcode primers (98°C for 10 sec pre-denaturation followed by 15 cycles of 98°C for 5 sec ...
-
bioRxiv - Molecular Biology 2023Quote: ... which includes the genomic sequence beginning at the end of the gene just upstream of SIC to the end of the SIC coding sequence (without the stop codon) was made with Q5 High-Fidelity DNA Polymerase (New England Biolabs) in three steps ...
-
bioRxiv - Molecular Biology 2023Quote: ... were amplified out of cDNA from Arabidopsis Col-0 or an SICp:SICm-Venus-HA transgenic line (see below) by PCR with Q5 High Fidelity Polymerase (New England Biolabs, www.neb.com). Primers “WARP2cdsGATEF” and “WARP2cdsR” were for SIC and primers “DBR1_CDS_nostp_CACC_F” and “DBR1_CDS_stp_R” were for DBR1 (Table S1) ...
-
bioRxiv - Microbiology 2023Quote: ... 1399 bp fragments flanking between the 271 bp upstream to the chpG ORF and 294 bp downstream to the chpG ORF were amplified with Q5 high fidelity DNA polymerase (NEB) using gene specific primers (Table S3) ...
-
bioRxiv - Molecular Biology 2023Quote: The extracted DNA was used as a template to amplify the variable region by a two-step PCR strategy using a high-fidelity DNA polymerase (NEBNext ultra II Q5 master mix, M0544L, NEB). The first PCR of 22-24 cycles was performed using primers #232 to #273 (Table S9 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 kb of genomic DNA upstream of the TgAPT1 stop site was amplified by PCR using Q5 high fidelity polymerase (New England BioLabs) using the Ku80 genomic DNA as a template and the primers TgAPT1 F1 and TgAPT1 R1 (Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... The mWasabi sequence under the control of the constitutive Pleft* promoter45 was amplified by PCR using a Q5 high-fidelity DNA polymerase (New England Biolabs). Plasmids were linearized with KpnI-HF (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of indexed P7 (Cao et al., 2017) and 20 μl of NEBNext High-Fidelity master mix (New England Biolabs) were added to each well and PCR performed as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... from which a 500 bp dsDNA containing the λC31 attB at its center was generated by PCR using Phusion High Fidelity PCR Master Mix from NEB. After heat denaturation ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...