Labshake search
Citations for New England Biolabs :
3601 - 3650 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... to pcDNA4/TO and PiggyBac-CMV-MCS-IRES-mCherry and PiggyBac-CMV-MCS-IRES-mNeongreen by PCR using Q5 High Fidelity 2X mastermix (NEB). PiggyBac-CMV-MCS-IRES-NLS-TagBFP was used as empty vector control ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA cassette was PCR amplified from genomic DNA using Phusion High-Fidelity PCR Master Mix (New England Biolabs, M0531S). The amplified products were pooled and amplified again via PCR using primers harboring Illumina TruSeq adapters with i5 and i7 barcodes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The point mutations G729E and G719F were introduced into the EGFR-WT expression vector by PCR using Phusion high fidelity DNA polymerase (New England Biolabs). PCR product obtained was digested by methylation-specific enzyme DpnI (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... primers 972 and 973 were designed to amplify the fragment by PCR with Q5 polymerase and high-GC buffer (NEB). The barcode fragment and pKS1 were both digested with NcoI and BamHI and ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 ng of DNA was inputted into a first round of PCR (27 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to attach common overhangs and amplify the target locus ...
-
bioRxiv - Genomics 2023Quote: ... The two primer pools were used to generate tiled amplicons using Q5 high-fidelity 2X master mix (New England Biolabs), followed by a clean up step and quantification using the Qubit ...
-
bioRxiv - Cell Biology 2023Quote: ... human FAM111B cDNA (FW: GGGGACAAGTTTGTACAAAAAAGCAGG CTTCAATTCCATGAAGACTGAAGAAAAC and RV: GGGGACCACTTTGTACAAGAAAGCT GGGTCCTAACATTCCATGGGTTCAATC) was amplified using high fidelity Q5 DNA polymerase (New England Biolabs), cDNA template (kind gift from Dr Nicola Burgess-Brown ...
-
bioRxiv - Neuroscience 2023Quote: ... a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer ...
-
bioRxiv - Cell Biology 2023Quote: ... eluted in 20 µl of water and PCR amplified using 25Lμl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541LL), 2.5Lμl of each i5 and i7 Illumina index adapter (IDT ...
-
bioRxiv - Biophysics 2023Quote: HeR-48C12 was amplified from pBAD-Helios-NT-6xHis and combined with TSX3ER2 and Citrine using overlap-extension PCR with Phusion high fidelity master mix (NEB). The primers used for cloning are listed in the Supporting Information (SI ...
-
bioRxiv - Microbiology 2023Quote: ... V3-V4 region of 16S rRNA gene was amplified using specific primers with the barcode and Phusion High-Fidelity PCR Master Mix (New England Biolabs). PCR products were mixed at equal density ratios ...
-
bioRxiv - Biochemistry 2023Quote: ... Vector and insert fragments were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF buffer from New England Biolabs (NEB). The fragments were analyzed by agarose gel electrophoresis and template DNA was digested using DpnI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragments needed to assemble the constructs encoding GADD34Δ and K3L were PCR amplified using Q5 High-Fidelity DNA polymerase (NEB) from plasmid templates (gift of A ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the desired histidine residues and used them to amplify the gene of interest using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs). After PCR amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Plant Biology 2023Quote: ... The 25-μl reactions contained: 12.5 μl Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, United Kingdm), 1.25 μl forward primer (10 μM) ...
-
bioRxiv - Cell Biology 2023Quote: ... high-molecular weight genomic DNA (gDNA) was isolated by phenol-chloroform extraction and digested with 50 U AluI (NEB, R0137L) and 50 U MboI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA barcodes were amplified from genomic DNA using universal primers JSW-SS-170 (CGACGCTCTTCCGATCTNNNNN TGATGTCGTTGTTGCCATCG) and JSW-SS-171 (ACTGACGCTAGTGCATCA CTTTCTGAGCCAGTGTTGCT) and the Q5 Hot Start High-Fidelity 2X PCR master mix (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Cancer Biology 2023Quote: ... Entire DNA sample was amplified in several 30 cycle reactions using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), the amplicons were digested with DpnI (thermo scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB). Point mutations and deletions in mouse p75NTR and RhoGDI were introduced using NEB Q5 polymerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25 µM of forward and reverse primers mixed in a final volume of 25 µl reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reaction was performed using 1 μl of undiluted cDNA template synthesized from 1 µg of total RNA extracted from a mix of male and female individuals using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), as described above ...
-
bioRxiv - Plant Biology 2023Quote: ... were synthesized by Gen9 Bio (San Jose, CA) and amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England BioLabs) and gene-specific primers from Integrated DNA Technologies (Supplementary Table 11) ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 21-base pair (bp) barcodes (post-culture) were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Primers used are listed in Supplemental Table 11 ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... 1 Kb homology arms beginning at the predicted Cas9 cut sites in ppk23 were PCR amplified with Q5 High-Fidelity master mix (NEB) and cloned into pIM174 ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Microbiology 2023Quote: ... the full-length 16S rDNA sequence amplified with primers 8F and 1522R (Turner et al., 1999) with High Fidelity Q5 Taq polymerase (NEB). A high-quality sequence was obtained by the Sanger method and was used to query the 16S rRNA BLAST database ...
-
bioRxiv - Genetics 2023Quote: Three-prime Rapid Amplification of cDNA ends was performed following the protocol of Scotto-Lavino et al.(38) using Phusion High Fidelity Polymerase (NEB) and the following two Gene Specific Primers ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Microbiology 2023Quote: PCR reactions were performed by 30μL reactions using 15μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, USA), 0.2 μM of primers
-
bioRxiv - Genomics 2023Quote: ... the neomycin resistance gene (NeoR) was amplified from pcDNA-dCas9-p300 Core (addgene #61357) via PCR with Phusion Phusion High-Fidelity DNA Polymerase (NEB), using primers to add a 5’ BamHI site and Kozak sequence and a 3’ MluI site (For primer sequences see Additional file 2 ...
-
bioRxiv - Genomics 2023Quote: The circularized cDNA (1 µL) was amplified by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB M0494L) in a 25 µL reaction containing 12.5 pmoles of forward and reverse primers (primers listed in Supplementary Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... All PCR reactions were performed in 50 μL reactions using Q5 High-Fidelity 2X Master Mix (New England Biolabs, M0492L). Primers for genomic DNA amplification are included in Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... Polymerase chain reactions (PCR) were performed with Taq polymerase (Feldan) for screening purposes or Q5 high-fidelity DNA polymerase (New England Biolabs) for cloning and site-directed mutagenesis ...
-
bioRxiv - Microbiology 2023Quote: ... biwaensis Akk2750 (100% sequence match to CSUN-19) (38) with Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and incorporating a C-terminal HA epitope tag ...
-
bioRxiv - Molecular Biology 2023Quote: Templates for riboprobe synthesis were generated by TA-mediated cloning of pre-amplified cDNA sequences (Q5 High-Fidelity DNA Polymerase, New England Biolabs, Germany & AccuPrime Taq DNA Polymerase ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs) and the following primers:
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... Bisulfite-converted DNA was amplified using the oligonucleotides #2479 and #2480 (Supplemental Table S1) and the Q5U Hot Start High-Fidelity DNA Polymerase (New England Biolabs). PCR products were sequenced at Eurofins Scientific using the NGSelect Amplicon option (2-step amplicon generation workflow).
-
bioRxiv - Developmental Biology 2023Quote: ... The mCherry-Trim21 fragment was PCR amplified (Phusion high fidelity DNA polymerase, MO530S) to introduce ClaI restriction sites (fwd TAATTATCGATTATAATGGTGAGCAAGGGCGAGGA, rev TATTAATCGATCCGCTCACATCTTTAGTGGACAGA) The PCR product was purified (NEB Monarch PCR and DNA purification kit ...