Labshake search
Citations for New England Biolabs :
3101 - 3150 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing libraries were prepared with the NEBNext mRNA library Prep Master Mix Set for Illumina (New England BioLabs, cat#: E6110), passed Qubit bioanalyzer and qPCR QC analyses ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Microbiology 2023Quote: Abortive/PCD systems identified by transposon screening of conditionally lethal AGs were cloned by Gibson assembly using the NEBuilder HiFi DNA assembly master mix (NEB) onto pBAD Myc/His A vectors along with their native promoters wherever possible ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in case of multiplexing the EXP-NBD104 extension was combined with NEB Blunt/TA Ligase Master Mix (M0367, New England BioLabs (NEB)) ...
-
bioRxiv - Bioengineering 2024Quote: ... the coding sequence of PE2 and PEmax were cloned into the mRNA production plasmid using HiFi DNA Assembly Master Mix (NEB). mRNAs were transcribed to contain 101 nucleotide-long poly(A ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP libraries were prepared for Illumina NextSeq 500 using NEBNext ChIP-Seq DNA Sample Prep Master Mix Set for Illumina (E6240; NEB) and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 ...
-
bioRxiv - Microbiology 2023Quote: ... and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions followed by Sanger sequencing of the cloned gene ...
-
bioRxiv - Cell Biology 2023Quote: Wildtype or deletion mutants of DNAJC17 were ordered as gBlocks (IDT) and cloned into pLV-EF1-Hygro using NEBuilder Master Mix (NEB). Codon-optimized sequences of DNAJC17 (WT ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Double-stranded DNA was converted into an Illumina sequencing library using an NEBNext Quick DNA Library Prep Master Mix Set for 454 (New England BioLabs) with 20 μl of DNA extract without DNA fragmentation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Ligation and assembly of DNA fragments were performed with NEBuilder® HiFi DNA Assembly Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG ...
-
bioRxiv - Genomics 2024Quote: ... and a total of 50 ng was used as a template for PCR amplifications encompassing ebony exons e1 and e2 with OneTaq HS Quick-Load Master Mix with Standard Buffer (NEB) as described before.
-
bioRxiv - Neuroscience 2024Quote: We amplified the full-length Ncan sequence by PCR from the mouse brain cDNA library and assembled it into the pCAG-GFP vector using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) or In-Fusion HD Cloning Kit (TaKaRa) ...
-
bioRxiv - Genetics 2024Quote: ... 1998) was amplified by PCR and then inserted into the pBS vector using NEBuilder HiFi DNA Assembly Master Mix (NEB) to generate pBS-UASp ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR products were assembled using 75 ng of the backbone PCR DNA and 12.5 ng of the PCR amplified library in a 15 μL Gibson assembly reaction using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) at 50 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR amplification was performed using NEB primers for 15-16 cycles using the Q5 Hot Start HiFi PCR Master Mix (NEB). The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent) ...
-
bioRxiv - Genomics 2024Quote: RRS-lysO and RRS-dusC sequences were amplified from MG1655 genomic DNA using Q5 High-Fidelity master mix (New England Biolabs) and pairs of primers containing a MfeI restriction site at each end ...
-
bioRxiv - Cancer Biology 2024Quote: ... modified with an EF1a promoter and a Basticidin resistance gene using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Specific primers and NEBuilder HiFi DNA Assembly Master Mix were used to introduce the exon E6a or the R238W mutation into the canonical sequence of NT5C2.
-
bioRxiv - Microbiology 2024Quote: ... ONT’s proprietary sequencing adaptors were ligated to the DNA fragments using the Blunt/TA Ligase Master Mix (New England Biolabs) provided in the Ligation Sequencing Kit ...
-
bioRxiv - Biochemistry 2024Quote: The Daed coding region was amplified from total OSC RNAs by RT-PCR and inserted into pAc-Flag-Armi WT51 by substituting the Armi coding region using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). RNAi-resistant Daed WT and its ΔSAM and ΔCC mutants were generated by inverse PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Biochemistry 2024Quote: ... The resulting DNA molecules were ligated into a pET28a vector (kanamycin resistance) with Instant Sticky-end Ligase Master Mix (NEB) and transformed for amplification in DH5α E ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: The sgRNA-containing region of the lentivirus in the sample DNA was PCR amplified using NEBNext Ultra II Q5 Master Mix as per manufacturers’ instructions (New England Biolabs), and with primers (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons were then cloned into the wild-type SsCBE-UGI-C2 vector using Gibson Assembly Master Mix (New England Biolabs). The cjSsCBE2 was constructed by exchanging APOBEC1 domain of cjCBEmax to SsdAtox-SRE domain ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
bioRxiv - Molecular Biology 2024Quote: ... The mCherry gene was excised from pL1694 by BamHI and NotI and replaced by a human codon-optimised spCas9 from pUF1-Cas912 by Gibson cloning (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, NEB) to generate pL1694-GIMO-Cas9.
-
bioRxiv - Microbiology 2024Quote: Assembly of the transposon mutagenesis plasmid pTn donor (pTn) and the Cre-expressing plasmid pCre was performed using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Fragments were generated through PCR amplification from plasmid or genomic DNA templates using primers acquired from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ligation products were purified by 1.1×DNA FragSelect XP Magnetic Beads and amplified by 12-15 cycles of PCR with NEBNext Ultra II Q5 Master Mix and NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 190 ng of linearized vector and 13.15 ng of each sub pool were used for each Gibson reaction of 80 µL using HIFI DNA Assembly Master Mix (NEB). The Gibson reaction was incubated for 1 hr at 50°C and DNA was isolated by isopropanol precipitation and transformed into Lucigen Endura Competent Cells according to manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... Plasmids were cloned in house using Gibson Assembly with the NEB Hifi Builder Master Mix (New England Biolabs, Ipswich, MA) and/or contracted (GenScript ...
-
bioRxiv - Bioengineering 2023Quote: ... 2x NEB r2.1 Buffer (New England Biolabs), 5 μM fluorescent ssDNA probe (6-FAM/TTATT/BHQ1) ...
-
bioRxiv - Microbiology 2023Quote: ... 7.5 μl LongAmp Taq 2X ReadyMix (NEB) with volume made upto 15 μl with nuclease free water ...
-
bioRxiv - Microbiology 2023Quote: ... a 2X OneTaq mastermix (New England Biolabs) was mixed with 1 µL template DNA and a final concentration of 0.5 µM of each primer.
-
bioRxiv - Plant Biology 2020Quote: ... YFP and CESA6 genomic sequence through Gibson Assembly method using a Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA). The construct was verified by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: Primers were designed to generate overlapping fragments that were assembled using the Gibson assembly master mix (New England Biolabs, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified 10 uL of cDNA in 100 uL PCR reactions using NEBNext Ultra II Q5 Master Mix (NEB, M0544S) and Lib_Seq_eGFP_F2 and Lib_Hand primers for either 8 or 3 cycles (MPRA 1 and 2 respectively) ...
-
bioRxiv - Genetics 2021Quote: ... This single-stranded oligo pool was then combined with the linearized library vector for assembly using the NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four exons and three introns of Mlst8 were PCR amplified with primers listed in Table S1 and then cloned into the pCAG backbone using the Gibson Assembly Master Mix (NEB, #E2611S). Similarly ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The PCR product was purified and then cloned into gRNA-expressing or shRNA-expressing vector using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621). 100 ng product was then transformed into Endura ElectroCompetent cells according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The reactions were then column-purified and we assembled the PCR amplified vector and promoters using Gibson assembly (Gibson et al., 2009) with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). The assembly mix was then electroporated directly into the electrocompetent MG1655 strain ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each reaction with randomly mutated promoter variants was column-purified before Gibson assembly with the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Each assembly mix was then electroporated into the MG1655 strain and colonies that grew on LB with Kanamycin were picked for Sanger sequencing and stored as glycerol stocks ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a 450 bp long (HAR sequence)) were introduced using the NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) in combination with the sequences produced as gene blocks (IDT ...
-
bioRxiv - Genomics 2020Quote: ... The tagmented cDNA was then amplified with barcodes using the Phusion High Fidelity PCR master mix (New England Biolabs cat# M0531L). The amplification program was set to 1 ...