Labshake search
Citations for New England Biolabs :
2551 - 2600 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Full plasmid sequences and descriptions of the individual cloning steps can be provided upon request ...
-
bioRxiv - Microbiology 2019Quote: ... A master mix of purified Venus mRNA (500 ng per reaction) and PureExpress (New England Biolabs, Ipswich, MA) components were prepared in duplicate reactions with a range of concentrations of purified Msm LepA ...
-
bioRxiv - Genomics 2020Quote: All pooled plasmid libraries were constructed by Gibson-style assembly using HiFi DNA assembly master mix (NEB E2621L) and transformed using either ElectroMAX DH10B (ThermoFisher #18290015 ...
-
bioRxiv - Cell Biology 2022Quote: ... All other plasmids generated in this study were assembled by Gibson Assembly Master Mix (New England Biolabs Inc.) according to manufacturer instruction ...
-
bioRxiv - Molecular Biology 2022Quote: LAMP assays were optimized with Loxosceles similis DNA using Master Mix reagent (WarmStart® #M1800 – New England BioLabs). For this ...
-
bioRxiv - Bioengineering 2021Quote: ... and were created using Gibson Assembly[51] using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA) and custom DNA oligonucleotides purchased from Integrated DNA Technologies (Coralville ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then assembled these two fragments using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) with the help of four single strand oligo bridges (Supplementary Table 3) ...
-
bioRxiv - Genomics 2019Quote: ... 2 min at 50ºC and 15 min at 72ºC) using Phusion High-Fidelity PCR Master Mix (New England Biolabs). A biotinylated oligo (Bio NotI-P 5 -P ET ...
-
bioRxiv - Microbiology 2019Quote: ... All the PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The libraries generated with TruSeq DNA PCR-Free Sample Preparation Kit were sequenced using paired-end Illumina sequencing (2 × 250 bp ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR reactions were performed with the Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs). All inserts were verified by sequencing (GENEWIZ) ...
-
bioRxiv - Cancer Biology 2020Quote: ... the entry vector and the PCR fragments were assembled using the Gibson Assembly Master Mix (New England BioLabs), following manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... 135 ng purified PCR product from the previous reaction and 25 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Microbiology 2020Quote: ... combined and assembled in vitro using the NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 11) with 15 cycles of PCR using NEBNext® Q5® Hot Start HiFi PCR Master Mix (NEB), which allowed to add Gap Repair recombination sequences for the cloning in Gal4-AD prey plasmid pP7 ...
-
bioRxiv - Genomics 2021Quote: ... ONT) and the NEBNext End repair / dA-tailing Module NEB Blunt/TA Ligase Master Mix (New England Biolabs) according to the manufacturers’ instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... The purified PCR products were then assembled into intact plasmid using Gibson Assembly Master Mix (NEB, Cat.No. E2611). The newly assembled plasmid was transformed into E.coli Trans5α chemically competent cells (Transgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The adapter was ligated to the end-repaired DNA using Blunt/TA Ligase Master Mix (New England Biolabs). The final library was eluted from 0.4X Ampure XP beads after washing 2 times by Adapter Bead Binding buffer (SQK-LSK108 Ligation Sequencing Kit 1D) ...
-
bioRxiv - Plant Biology 2019Quote: ... The glgC and gnd knock out plasmids were constructed using HiFi DNA Assembly master mix (NEB, Ipswich, MA). S ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification was performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs) and primers KhE5-4 (GACGGTGACACTGTTCATGC ...
-
bioRxiv - Cell Biology 2021Quote: ... Insertion of truncated pTF.CREG1 into linearized PtpBAD-CTHF was performed using Gibson Assembly Master Mix (NEB, Catalog #E2611S), 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB ...
-
bioRxiv - Physiology 2021Quote: ... Gibson assemblies were performed with the NEBuilder HiFI DNA Assembly Master mix (New England Biolabs, Ipswich, MA, USA) with the total reaction volume downscaled to 5 µL and a total incubation time of 1 h at 50 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: Sequencing libraries were built using NEBNext DNA Library Prep Master Mix Set for 454 (E6070, New England Biolabs) and Illumina-specific adaptors66 following established protocols66–68 ...
-
bioRxiv - Microbiology 2020Quote: ... The two fragments were ligated using the NEBuilder HiFi DNA Assembly master mix (New England BioLabs, Ipswich, MA) yielding the pHT009-lsaA plasmid (VHp369 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10uM Illumina compatible forward and reverse PCR primers were added together with Q5 master mix (NE Biolabs, M0544S) followed by Ampure XP purification with 1:1 ratio ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Immunology 2020Quote: ... before amplification with Illumina adapter-containing primers (Nextera i7 indices) and NEBNext Ultra II Q5 Master Mix (NEB) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in Fast AP Master Mix (1x Fast AP Buffer containing 80U RNase Inhibitor (M0314, NEB), 2U TURBO DNase (AM2238 ...
-
bioRxiv - Immunology 2021Quote: ... and second strand synthesis was carried out by resuspending beads in a master mix containing Klenow Fragment (NEB), dNTPs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and barcoded libraries were generated using the NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) and Nextera index primers (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were PCR amplified from the entire isolated genomic DNA using NEBNext Ultra II Q5 Master Mix (NEB) and the primers v2.1-F1 and v2.1-R1 ...
-
bioRxiv - Genomics 2022Quote: ... Amplified gRNA cassettes were cloned using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA) into lentiGuide-Puro (Addgene plasmid #52963) ...
-
bioRxiv - Immunology 2022Quote: ... PCR reaction was set up according to NGS protocol of NEBNext UltraTM II Q5 Master Mix (NEB, Cat.M0544S). PCR products were purified by AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Genomics 2022Quote: ... The SDS was then neutralized with Triton X-100 and libraries were amplified with NEBNext Master Mix (NEB) using 12 rounds of amplification ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification of the dhodh locus was performed using Phusion High-Fidelity PCR Master Mix (New England BioLabs) as per the protocol ...
-
bioRxiv - Immunology 2022Quote: ... The gBlocks were inserted into a pcDNA 3.1+ Zeocine plasmid using Gibson assembly master mix (New England Biolabs). The cDNA construct encoding LAIR-1 ectodomain (sLAIR-1ecto ...
-
bioRxiv - Microbiology 2022Quote: The RGB-S reporter was assembled using the isothermal cloning reaction44 Gibson Assembly® Master Mix (NEB inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... tagmented DNA was PCR amplified using 1x Phusion® High-Fidelity PCR Master Mix with GC Buffer (NEB) and 1.25 μM i5 and i7 PCR primers (Nextera® Index Kit (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... we amplified the targeted gene regions by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers (Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x 10 µl Phusion® High Fidelity PCR master Mix with HF buffer (Biolabs new England M0531S). The thermocycler program was 94 °C for 30 sec ...
-
bioRxiv - Neuroscience 2024Quote: ... N2-A225 and I256-A2731 were deleted using the NEBuilder HiFi DNA assembly master mix (New England Biolabs), respectively.
-
bioRxiv - Genomics 2024Quote: ... The target locus was amplified from gDNA by PCR using NEBNext Ultra II Q5 Master Mix (#M0544L, NEB). Adapters for dual-indexed Illumina sequencing were attached in a second PCR step ...
-
bioRxiv - Genomics 2024Quote: ... Target loci were amplified from purified gDNA by PCR using NEBNext Ultra II Q5 Master Mix (#M0544X, NEB). Adapters for dual-indexed Illumina sequencing were attached in a second PCR step ...
-
bioRxiv - Genomics 2024Quote: ... The linearized plasmid library and barcoding oligo were assembled with NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) at a 1:5 molar ratio ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Microbiology 2024Quote: ... and combined with corresponding gene inserts in Gibson reactions (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs) to allow integration of targeted genes ...
-
bioRxiv - Genetics 2023Quote: ... Gibson assembly was performed for 1 hour at 50°C using Gibson Assembly Master Mix (New England Biolabs), 500 ng backbone ...