Labshake search
Citations for New England Biolabs :
2351 - 2400 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: All constructs for mammalian cells were cloned with NEBuilder HiFi DNA Assembly Master Mix (#E2621L, NEB) from PCR fragments obtained with Q5 High-Fidelity 2X Master Mix (#M0492L ...
-
bioRxiv - Molecular Biology 2022Quote: ... the adaptor-ligated cDNA was processed to library PCR amplification using Phusion Master Mix (NEB, M0531L) with IDT adaptor indexes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 ng P300core were mixed with NE Builder HiFi DNA Assembly Master Mix (Cat # E2623, NEB) and incubated at 50°C in thermal cycler for 1h ...
-
bioRxiv - Microbiology 2023Quote: ... primers for lacZ-LAupp: lacZupp_intF2 and lacZupp_intR2) and assembled using NEB Gibson Master Mix (NEB #E2611). 10 µL of the Gibson reaction was used to transform competent EC1000 cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and all PCR reactions were set up with Q5 Master Mix (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol.
-
bioRxiv - Synthetic Biology 2024Quote: ... We assembled the plasmids through Gibson Assembly using the NEBuilder HiFi DNA Assembly Master Mix (NEB) and followed the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Reverse: acctgaggagtgaattcacgcgttcactggcgacgccac) with Q5® Hot Start High-Fidelity master mix (Cat.#M0494, New England Biolabs) and purified by DNA gel electrophoresis ...
-
bioRxiv - Molecular Biology 2023Quote: Endpoint PCR was performed in a 20 µL reaction volume containing 1× OneTaq Master Mix (NEB), 0.2 µM of each primer and 1 µL of 100-fold diluted cDNA ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Genetics 2024Quote: ... and libraries were generated by PCR with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541). Prior to sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... Each 50 µL PCR2 reaction contains 25 µL of 2xQ5 Master Mix (New England Biolabs, M0494L), 5 µL of each index primer (N7xx or S5xx) ...
-
bioRxiv - Cell Biology 2024Quote: ... Each 100 µL PCR1 reaction contains 50 µL of 2xQ5 Master Mix (New England Biolabs, M0494L), 0.2 µL of MgCl2 (stock concentration at 1M) ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon barcode sequence was amplified by PCR using Q5 Ultra II FS Master Mix (NEB) with primers JBD-SS-310 (CGACGCTCTTCCGATCTNNNNNNN GATGTCCACGAGGTCTCT ...
-
bioRxiv - Synthetic Biology 2024Quote: All PCRs were carried out using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB), gel extractions using the QIAquick Gel Extraction Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2024Quote: ... All donor plasmids were assembled by Gibson assembly using NEB Gibson Assembly Master Mix (NEB, E2611L).
-
bioRxiv - Synthetic Biology 2024Quote: ... PCRs were carried out using the Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB) in a total volume of 20ul ...
-
bioRxiv - Genomics 2024Quote: ... Plasmid libraries were amplified using 1X NEBNext Ultra II Q5 Master Mix (New England Biolabs M0544), 1X EvaGreen dye (Biotium 31000) ...
-
bioRxiv - Microbiology 2024Quote: ... Version: NBE_9134_v112_revE_01Dec2021) using a NEB Blunt/TA Ligase Master Mix (New England Biolabs, cat. no. M0367), a NEBNext Quick Ligation Reaction Buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... Constructs were assembled by Gibson assembly using the Gibson Assembly® Master Mix (New England Biolabs) or by Golden Gate assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... comprising 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments for mll deletion vector pMS2 were fused using Gibson Assembly Master Mix (New England Biolabs), transformed into competent DH5α E ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR replication of Geneblocks was conducted using Q5® Hot Start High-Fidelity Master Mix (NEB; as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... purified and used for Gibson assembly using HiFi DNA assembly Master Mix (New England Biolabs, USA). Correct assembly of all constructs was confirmed by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... This was followed by the adapter ligation using the NEB Blunt /TA Ligase Master Mix (NEB) at room temperature for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... DNA assembly was done by using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, USA). DNA digestion was performed with FastDigest restriction enzymes (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR reaction was performed using NEBNext High Fidelity PCR Master Mix (NEB, catalog no. M0541L) for 20 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... digested plasmid and amplicon were assembled using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genetics 2022Quote: ... 25 µl LongAmp Hot Start Taq 2’ Master Mix (New England BioLabs, Frankfurt am Main, Germany). The PCR program was 94°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Gibson assemblies with the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, USA) and Golden Gate cloning with the NEBridge® Golden Gate Assembly Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and ligated with each respective vector by NEBbuilder HiFi DNA assembly master mix (New England BioLabs).
-
bioRxiv - Biochemistry 2023Quote: ... Each PCR consisted of: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 μL 10 μM forward primer ...
-
bioRxiv - Biochemistry 2023Quote: ... the following was mixed: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 μL 10 μM i5 indexing adapter ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were double-indexed and amplified using the NebNext Q5U Master Mix DNA Polymerase (NEB) using a number of cycles calculated using the qPCR analysis of 1 ul of library ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBuilder Assembly Tool was used to design the oligonucleotides and Gibson Assembly Master Mix (NEB) for the assembly reaction.
-
bioRxiv - Synthetic Biology 2023Quote: ... Gibson assembly was done using NEBuilder® HiFi DNA Assembly Master Mix (NEB cat no. E2621S) according to manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... General PCR for cloning was performed using the NEBNext PCR master mix (NEB cat no. M0541L), with 500 nM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid constructs were created by Gibson cloning with NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621L) or Gibson Assembly Master Mix (NEB E2611L) ...
-
bioRxiv - Molecular Biology 2023Quote: The resulting linear DNA fragments were assembled using the Gibson Assembly master mix (New England Biolabs). 5 μL of mix was added to 15-20 fmol of linearised vector and 4× excess of insert and topped up to 10 μL with double-distilled water (ddH2O) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were carried out using the Phusion High-Fidelity PCR Master Mix (New England Biolabs). The PCR products were selected by 2% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were gel-purified and assembled using NEBuilder® HiFi DNA Assembly Master Mix (NEB). The assembled product was transformed into NEB 5-alpha Competent E ...
-
bioRxiv - Microbiology 2023Quote: The second strand of cDNAs was synthesized using LongAmp Taq Master Mix [New England Biolabs (NEB)] and ONT PR2 Primer ...
-
bioRxiv - Bioengineering 2023Quote: ... All plasmid construction was done by Gibson Assembly (HiFi DNA Assembly Master Mix, New England Biolabs) and validated by colony PCR and sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the fragments were assembled with NEBuilder HiFi DNA Assembly master mix (NEB, Ipswich, MA, Cat# E2621L) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB, Ipswich, MA). The resulting plasmid was used as the template for amplification of GFP and 3’ UTR sequences using primers RA1791 and RA1799 ...
-
bioRxiv - Microbiology 2024Quote: ... phi47 orf65 (tifA) and orf65-L32F were PCR amplified using Q5 master mix (New England Biolabs) and cloned into pLZ12A ...
-
bioRxiv - Cell Biology 2024Quote: ... with C-terminal fluorescent tags using seamless cloning (HiFi DNA Assembly Master Mix, New England Biolabs). The pLVX-KRT5-mNG-IRES-Puro construct includes an mNeonGreen (Allele Biotechnology ...
-
bioRxiv - Genomics 2024Quote: ... and amplified with 14 cycles of PCR using LongAmp Taq Master Mix (New England Biolabs, UK). cDNA was quantified using the Qubit DNA High sensitivity assay (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... Purified PCR fragments were assembled using Gibson Assembly® Master Mix (New England Biolabs, MA, USA) following the manufacturer’s procedures.