Labshake search
Citations for New England Biolabs :
2301 - 2350 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Both PCR products were used for constructing the final vector with Gibson assembly Master Mix (NEB), according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR amplified segments were assembled using NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... VC1086 was assembled with pVSV105 by Gibson assembly using NEBuilder HiFi DNA Assembly Master Mix (NEB). The Gibson reaction was transformed into chemically competent DH5α λpir and transformant candidates were selected using chloramphenicol ...
-
bioRxiv - Cell Biology 2022Quote: ... All fragments were cloned together using the Gibson Assembly® Master Mix (#E2611S, New England Biolabs), therefore all primes used for amplifying the fragments were designed to have an overhang to align to the adjacent fragment in the plasmid ...
-
bioRxiv - Immunology 2020Quote: ... 18ng heavy or light chain fragment and 10ul of Gibson assembly master mix (New England Biolabs). 5-alpha competent E ...
-
bioRxiv - Microbiology 2021Quote: ... The TurboGFP-Luciferase fusion reporter gene was constructed using Gibson Assembly Master Mix (New England Biolabs) to insert the TurboGFP open reading frame with a Ser-Gly-Ser-Gly Linker in front of the Met codon of the luciferase open reading frame ...
-
bioRxiv - Immunology 2020Quote: ... Each PCR reaction consisted of 50μL of NEBNext Ultra II Q5 Master Mix (NEB, Cat# M0544), 1μg of gDNA ...
-
bioRxiv - Microbiology 2022Quote: All LAMP reactions were conducted in the WarmStart colorimetric LAMP master mix (NEB Canada, Whitby, ON). Each reaction was 25 µL in total volume containing 1 µL template ...
-
bioRxiv - Genetics 2022Quote: ... Putative successful amplicon clones were identified by PCR amplification using 2xOneTaq Master Mix (New England Biolabs) with primers DLO883 (5’-CAGGAAACAGCTATGACCATG-3’ ...
-
bioRxiv - Genetics 2022Quote: ... Each PCR consisted of: 20 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 µL 10 µM i5 indexing adapter ...
-
bioRxiv - Genetics 2022Quote: ... the following was mixed: 20 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 µL 10 µM forward primer ...
-
bioRxiv - Genetics 2022Quote: ... ~30ng of each purified fragment were mixed and incubated with 10μl Gibson Assembly Master Mix (NEB) with pTA131 that was amplified with suitable primers ...
-
bioRxiv - Microbiology 2022Quote: ... A 20 μL ligation reaction was performed with 10 μL Blunt/TA ligase master mix (NEB), 100 ng of vector backbone ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and cloned into expression vectors using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). The Himar-dCas9 gene was cloned into a C-terminal 6xHis-tagged T7 expression vector (yielding plasmid pET-Himar-dCas9) ...
-
bioRxiv - Cell Biology 2019Quote: The GFP nonstop and stop reporters were constructed by Gibson cloning (Gibson Assembly Master Mix, NEB) eGFP with or without a terminal stop codon into the pCMV AAV backbone which was used as an expression vector and used to make AAV ...
-
bioRxiv - Molecular Biology 2020Quote: ... and indexed common primers (Vazyme, Cat.No.TD202) in 1 x Q5 High-Fidelity Master Mix (NEB, Cat.No.M0492). Then index PCR was performed as follow ...
-
bioRxiv - Molecular Biology 2019Quote: ... a master mix was prepared containing 2 µl 10x T4 polynucleotide kinase buffer without ATP (NEB) and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were assembled using NEBuilder® HiFi DNA Assembly Master Mix following manufacturer’s protocol (NEB, MA). All plasmid sequences were confirmed by DNA sequencing (Eton Bioscience ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix, New England Biolabs #E2611) into a pET-28c plasmid backbone ...
-
bioRxiv - Biochemistry 2020Quote: ... Both PCR steps followed the recommended temperatures and conditions using Q5 Master Mix (New England Biolabs). The PCR products from the first step were purified using 1% agarose gel ...
-
bioRxiv - Microbiology 2021Quote: ... and cloned into HDM_SARS2_Spike_del21_D614G by Gibson Assembly using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Assemblies were transformed into DH5-alpha chemically competent cells (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... This fragment was cloned into pDS132 using the NEB HiFI DNA Master Mix (New England Biolabs) and transformed into MFDλpir and plated on LB+ kanamycin + DAP ...
-
bioRxiv - Molecular Biology 2020Quote: ... F1+R6) (Fig 1D) with NEBNext Ultra II Q5 Master Mix (New England Biolabs, Ipswich, USA). PCR reactions were performed with 60 ng DNA samples from different experimental groups in 50 µl reaction mix using the PCR program 98°C for 30sec of denaturation followed by 35 cycles of 98°C for 10 sec ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genomics 2021Quote: ... the NEBNext End repair / dA-tailing Module NEB Blunt/TA Ligase Master Mix (New England Biolabs) was used.
-
bioRxiv - Cell Biology 2019Quote: ... and the FAP216 fragments then assembled into it using NEBuilder HiFi DNA assembly master mix (NEB), yielding pBC26 ...
-
bioRxiv - Plant Biology 2019Quote: ... and pEarleyGate101 vector were assembled by overlapping ends using Gibson assembly master mix (NEB, Ipswich, MA). TurboID was amplified with primers FP1 (5’-ATCCACCGGATCTAGAGGCAAGCCCATCCCCAAC-3’ ...
-
bioRxiv - Genetics 2020Quote: ... using 12.5 µL of Phusion® High-Fidelity PCR Master Mix NEB (New England Biolabs Inc.), and 2 µl of Illumina forward and reverse [10 µM] primers ™ ...
-
bioRxiv - Genetics 2020Quote: Transgene construction was performed using NEBuilder HiFI DNA Assembly Master Mix (New England Biolabs, Catalog E2621), restriction enzyme-digested plasmids ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification reactions were performed using Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Sanger sequencing (Genewiz ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... All PCR reactions were carried out with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The PCR products were mixed with an equal volume of 1× loading buffer (containing SYB green ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations were conducted using isothermal assembly with NEBuilder® HiFi DNA Assembly Master Mix (NEB, E2621L). All gBlocks ...
-
bioRxiv - Molecular Biology 2021Quote: DNA constructs were built using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs Cat. #E2621) and transformed into NEB 10-beta electrocompetent E.coli (New England BioLabs Cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids were generated by Gibson assembly of PCR fragments using the NEBuilder HiFi Master Mix (NEB). Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2 ...
-
bioRxiv - Genetics 2020Quote: ... Each 20 μl barcoding reaction contained 10 μl Q5 High-Fidelity Master Mix (New England Biolabs), 0.8 μl forward (universal ...
-
bioRxiv - Genomics 2020Quote: ... The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB) as per manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... The targeting construct was generated by Gibson assembly (Gibson Assembly Master Mix kit, New England Biolabs) of the PCR-amplified tag sequence and roughly 520bp homology arms surrounding the ATG start codon of the Med14 gene ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) in an assembly containing 5 fmol of each fragment ...
-
bioRxiv - Genomics 2021Quote: ... The insert and the backbone were assembled using Gibson Assembly Master Mix (New England Biolabs, #E2611L).
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... DNA fragments were enriched by PCR using NEB Next Ultra II Q5 Master Mix (NEB M0544S), before final clean up using Sera-Mag beads ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The various msrDL mutants were cloned via quickchange mutagenesis by amplifying pMMB-msrDL-msrD(1-3):yfp with primers 36 to 51 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Recoded sequence without the 7A codon (ATGTACCTGATCTTCATGTAA ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then amplified using NEBNext High Fidelity PCR Master Mix (M0541S, New England Biolabs Inc.) and barcoded primers (see table MMX) ...
-
bioRxiv - Cancer Biology 2022Quote: All the plasmid constructs were generated using NEBuilder® HiFi DNA Assembly Master Mix (NEB, E2621L) as per the vendor’s instructions with some modifications ...
-
bioRxiv - Microbiology 2022Quote: ... These amplicons were ligated together using the Gibson Assembly Master Mix (New England Biolabs, Ipswich MA) and the construct was re-amplified with ecwaaLfwdxhoI and ecwaaLrevxhoI primers to generate the modified 1,260 base pair amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Cloning was performed using the isothermal assembly method (NEBuilder HiFi DNA Assembly Master Mix, NEB #E2621). The vector was prepared by excising the GFP-MIOX gene fragment from a PGAL10-GFP-MIOX22 yeast integrative plasmid by restriction enzyme digestion (ClaI + XhoI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA assembly was performed using the HiFi Assembly Master Mix (NEB GmbH, Germany, Art. No. E5520S). For plasmid circularization ...
-
bioRxiv - Microbiology 2022Quote: Transfection plasmids were constructed by Gibson assembly using NEB Gibson Assembly Master Mix (New England Biolabs). Supplementary Table 1 provides the sequences of all primers used in this study.
-
bioRxiv - Plant Biology 2023Quote: ... Amplifications were performed using the High-Fidelity Phusion PCR Master Mix (NEB, Frankfurt am Main, Germany) or the GoTaq G2 polymerase (Promega ...