Labshake search
Citations for New England Biolabs :
2051 - 2100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... using the high-fidelity Phusion DNA polymerase (NEB) and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript) ...
-
bioRxiv - Developmental Biology 2024Quote: ... chromatin underwent digestion with the DpnII enzyme (1000U total; NEB, R0543M) at 37°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 PCR cycles for enrichment of adaptor-ligated DNA with unique dual index primer pairs from NEB. The libraries were sequenced on the NovaSeq 6000 system with NovogeneAIT Genomics ...
-
bioRxiv - Developmental Biology 2024Quote: ... 24𝜇l 10x Exo1 reaction buffer and 48𝜇l Exonuclease I (New England Biolabs), into each well and incubating in a thermocycler for 30min at 37°C followed by 15min at 80°C ...
-
bioRxiv - Genetics 2024Quote: ... of 8 or greater were subjected to Poly-A enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB catalog number E7490). NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (catalog number E7760L) ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genetics 2024Quote: ... 10 μg of the purified RNA was then polyadenylated by 4U poly(A) polymerase (New England Biolabs) at 37°C for 1 hr and purified again by illustra microspin G-50 column or Direct-zol RNA Miniprep kits (Zymo Research ...
-
bioRxiv - Genetics 2024Quote: ... Each of the four cDNA products was then used as a template in a PCR with the same primers and Phusion® High Fidelity DNA Polymerase (New England Biolabs). All primer pairs were located within the 5’- and 3’-UTRs of the transcripts so that they amplified the entire protein coding sequence of the respective genes (Figure 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... and NEBNext High Fidelity 2X PCR Master Mix (NEB, M0541). After purification with Qiagen MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... RUW regions were amplified from genomic DNA of transfected populations via PCR with the high fidelity Q5 polymerase (New England Biolabs, Cat. #M0491S), with an annealing temperature of 62 degrees and performing 35 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... The amplified DNA was inserted into the Hsp68-lacZ vector using the Gibson Assembly kit (E2611S, New England Biolabs). The resulting constructs were verified ...
-
bioRxiv - Developmental Biology 2024Quote: ... or SP6 RNA polymerase (NEB, M0207S; sense probe). Embryos used for in situ hybridization were fixed in 4% PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... and both reverse transcription and PCR were performed using the Luna One-Step Universal RT-qPCR kit (NEB, E3005S) and carried out on the Mic qPCR Machine (BioMolecular Systems ...
-
bioRxiv - Developmental Biology 2024Quote: ... The rbpms2bsa9329 surrounding genomic region was amplified for 35 cycles with an annealing temperature of 60°C and the mutant allele was digested with MboII (New England Biolabs, R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... The region around the miossa22946 allele was amplified for 35 cycles using 60°C for annealing and the mutant allele was identified by restriction enzyme digestion with DdeI for 1 hour (New England BioLabs, R0175S). The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.5% SDS) with 10 µg proteinase K (New England Biolabs, P8107S), vortexed briefly ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Developmental Biology 2024Quote: ... R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs, R0158S) for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... Q5® Site-Directed Mutagenesis (New England BioLabs, Inc.) was used to introduce nonsynonymous mutations into the mlc-4 sequence to generate mlc-4(T15D ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 0.2% DMSO (New England BioLabs B0515A) as control ...
-
bioRxiv - Developmental Biology 2024Quote: ... and mRNA was transcribed in vitro from the templates using HiScribe T7 ARCA mRNA Kit with Tailing (NEB, E2060) or mMESSAGE mMACHINE SP6 Transcription Kit (Thermo ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA libraries underwent PCR amplification (NEB-Next High-Fidelity 2x PCR Master Mix, New England Biolabs), indexing using previously described primers (Buenrostro et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA libraries underwent PCR amplification (NEB-Next High-Fidelity 2x PCR Master Mix ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.4 U/ul RNAse Inhibitor (New England Biolabs), 0.2 U/ul SUPERase•In™ RNase Inhibitor (Invitrogen)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which the library amplification was one with Phusion High-Fidelity DNA Polymerase (New England Biolabs) during which the Illumina adapters were introduced ...
-
bioRxiv - Developmental Biology 2024Quote: ... coli DNA ligase (New England Biolabs). After the second strand synthesis the cDNA of all single cells of a plate were pooled ...
-
bioRxiv - Developmental Biology 2024Quote: ... Ribosomal RNA was depleted from the total RNA using the NEBNext rRNA Depletion kit (New England Biolabs), followed by the conversion of the remaining RNA into an Illumina sequencing library using the NEBNext Ultra Directional RNA Library Prep kit (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2uL 10uM uniquely barcoded i7 primer and 25uL PCR master mix (NEB Phusion® High-Fidelity PCR Master Mix with HF Buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the Cap structure analog (New England Biolabs). Pink Flamindo mRNA was synthesized with the mMESSAGE mMACHINE T3 Transcription kit (Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2024Quote: ... RNA-seq libraries were prepared with NEBNext Ultra I Directional RNA Library Prep with rRNA Depletion (New England Biolabs, Inc., Ipswich, MA). Reads were aligned (Novoalign ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by the conversion of the remaining RNA into an Illumina sequencing library using the NEBNext Ultra Directional RNA Library Prep kit (New England Biolabs). Following library preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... The ribosome profiling library was prepared using NEBNext Multiplex Small RNA Library Prep Set (New England Biolabs).
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Genetics 2024Quote: ... Primary restriction enzyme digest was performed using DpnII (Cat. No. R0543S) and secondary digestion with CviQI (Cat. No. R0639S) from NEB. Before sequencing a final cleanup using SPRI select beads from Beckman Coulter (Cat No ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around rbpms2aae30 was amplified for 35 cycles with an annealing temperature of 60°C and the wild-type allele was digested with HaeIII for 1 hour (New England Biolabs, R0108S)2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The surrounding tsc2vu242 genomic region was amplified for 35 cycles with an annealing temperature of 57°C and the wild-type allele was digested with HpyCH4IV for 1 hour (New England Biolabs, R0169S). Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Developmental Biology 2024Quote: All PCR reactions were done in 50𝜇l volume using Q5 high fidelity polymerase (NEB) following NEB Q5 high fidelity PCR protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR reactions were performed using Phusion® high-fidelity DNA polymerase according to the manufacturer’s protocol (New Englang BioLabs). Amplified flanking recombination regions were merged with the MX cassette through Circular Polymerase Exchange Cloning into the pUC19 plasmid [67] ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and unligated ends were treated with Exonuclease III (NEB, M0206) to remove biotin-dNTPs ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were barcoded using the NEBNext End repair/dA-tailing mix (NEB, E7546) and NEBNext Ultra II Ligation Module (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The isolated DNAs were fragmented using the NEBNext dsDNA Fragmentase (New England BioLabs), and paired-end libraries were constructed according to the Illumina TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and NEBNext Ultra II Ligation Module (NEB, E7595S). The final amplified libraries ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: Single oocytes were collected with NEBNext Single Cell Lysis Module (NEB #E5530S) in 8μl volume and flash-frozen and stored at −80°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Developmental Biology 2024Quote: ... NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB #E6420) was used for cDNA synthesis ...