Labshake search
Citations for New England Biolabs :
2251 - 2300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The digested plasmid and phosphorylated oligo cassettes were ligated with T4 DNA ligase (NEB #M0202L) at room temperature for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: The dePARylation activity of PARG was measured in the PARP1 Histone H4 Activity Assay (#K611, Tulip BioLabs). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2019) and cloned into lentiviral pLenti-CAG-mCherry vector using NEBuilder HiFi DNA assembly (New England Biolabs, E2621) to generate pLenti-Ncad WT-HA-mCherry or pLenti-Ncad W161A-HA-mCherry.
-
bioRxiv - Cancer Biology 2024Quote: ... or within GAPDH (GAPDH_RTPCR_F: TCACCAGGGCTGCTTTTAAC; GAPDH_RTPCR_R: ATCGCCCCACTTGATTTTGG) using Taq DNA Polymerase (New England BioLabs) with primer-specific annealing temperatures and cycle numbers (RPL22L1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pelleted RNA was resuspended in 20 µL nuclease-free water and treated with DNase I (New England BioLabs) for 10 minutes at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RRM2 fragments were amplified by PCR using Phusion polymerase (NEB, M0530L) and OriGene clone GC-Z9335-GS as template ...
-
bioRxiv - Cell Biology 2024Quote: ... A minimum of 75 µg of total RNA was used as starting material to purify poly(A) RNAs using Oligo d(T)25 Magnetic Beads (NEB, Cat # s1419S). 50 pmoles of linker (REL5 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated for 90 min with a 1:150 dilution of RNase III (New England Biolabs) in low-salt buffer (50 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Cell Biology 2024Quote: ... following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). To create pAK1440 (mamG-GFP) ...
-
bioRxiv - Cell Biology 2024Quote: ... following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). To create pAK1447 (GFP-mms6NTDmmsF) ...
-
bioRxiv - Cell Biology 2024Quote: ... following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs).
-
bioRxiv - Cell Biology 2024Quote: ... and the methylation efficiency verified by the CpG methylation-sensitive restriction enzyme BstUI (restriction site: CpG↓CpG, #R0518S, New England Biolabs, USA). The insert DNA fragments with or without methylation were ligated with the same double-digested splicing reporter vector DUP17512 ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: The sequencing library was constructed using the NEBNext Ultra II FS Kit (New England Biolabs) according to the prime-seq protocol ...
-
bioRxiv - Developmental Biology 2024Quote: A Primer Exchange Reaction concatemerization reaction (1X PBS; 10 mM MgSO4; dNTP, 0.6 mM of A, C, and T, NEB-N0446S ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.6 mM of A, C, and T, NEB-N0446S; 0.1 µM Clean.G; 800 U/ml Bst Polymerase, NEB-M0374L ...
-
bioRxiv - Developmental Biology 2024Quote: ... Final constructs were assembled by Gibson assembly (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Beads were resuspended in 63 μl Elution Buffer (NEB) and incubated at 34°C for 30 minutes prior to sample elution ...
-
bioRxiv - Developmental Biology 2024Quote: ... bulk-extracted genomic DNA from these strains was used to set up PCR reactions for each primer set using Quick Load Taq 2X Master Mix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were diluted in 90 μl Elution Buffer (NEB), mixed with 120 μl AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... gel purified and transcribed with DIG RNA labeling mix with either T7 RNA polymerase (NEB, M0251S; antisense probe), or SP6 RNA polymerase (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Q5 high fidelity DNA polymerase (NEB), PrimeStar Max (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... We verified that this guide RNA digested the Gbait plasmid in combination with Lba Cas12a (New England Biolabs) in an in vitro reaction (data not shown) ...
-
bioRxiv - Developmental Biology 2024Quote: ... one cell stage zebrafish embryos were injected with 50 nM EnGen® Lba Cas12a (Cpf1) (New England Biolabs) and each gRNA at a final concentration of 2 nM ...
-
bioRxiv - Developmental Biology 2024Quote: ... the Gbait and dld gRNAs were combined at 4.8uM each with 20uM Lba Cas12a protein (New England Biolabs) and incubated for 10 minutes at 370C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... restriction enzyme digest assay with BtsCI (New England Biolabs) was performed to identify WT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Developmental Biology 2024Quote: ... Rehybridized products were incubated with 1.5 μl T7 endonuclease I enzyme (New England Biolabs) at 37°C for 1 h and separated on 1.5% agarose gel.
-
bioRxiv - Developmental Biology 2024Quote: ... The cDNA sequence for dld was cloned from isolated cDNA using Phusion High Fidelity Polymerase (New England Biolabs) and cloned into a pME vector digested with EcoRI using Gibson Assembly and the following primers for homology ...
-
bioRxiv - Developmental Biology 2024Quote: ... the regulatory region of each gene was inserted into SmaI digested pUC19 together with GFP amplified from pPD95.75 using NEBuilder® HiFi DNA Assembly Master Mix (NEB - E2621). PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... and NEBNext High Fidelity 2X PCR Master Mix (NEB, M0541). After purification with Qiagen MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... RUW regions were amplified from genomic DNA of transfected populations via PCR with the high fidelity Q5 polymerase (New England Biolabs, Cat. #M0491S), with an annealing temperature of 62 degrees and performing 35 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs, E0554S). Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and libraries prepared using the NEBNext UltraII Directional RNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were then inverted onto a 35μL drop on parafilm of NEB Blunting Reaction (NEB, E1201): (1mM dNTPs ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids used in this study were obtained from the sources as noted in Table 2 or made by either restriction digest and ligation or PCR and NEBuilder HiFi DNA assembly (New England Biolabs E5520S). Insert sequences were ordered as custom GeneBlocks from IDT or isolated from existing plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 ng cDNA was amplified by PCR for 30 cycles using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs) using the following primers:
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs; Ipswich, MA) for 10–20 min in a 37°C water bath ...
-
bioRxiv - Cell Biology 2024Quote: ... Half of the DNA was methylated in vitro with the CpG methyltransferase M.SssI (M0226L, New England Biolabs, USA) using S-adenosylmethionine (SAM ...
-
bioRxiv - Cell Biology 2024Quote: ... approximately 1 μg of gDNA each sample was subject to bisulfite conversion for shotgun library construction (NEB Ultra II) and Illumina HiSeqX PE150 sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: Genomic DNA and cDNA PCRs were carried out using OneTaq polymerase (New England Biolabs, Ipswich, MA, USA) as per instructions ...
-
bioRxiv - Cell Biology 2024Quote: Proteins were expressed in Escherichia coli T7 Express lysY/Iqcells (New England Biolabs) in 2×TY medium at 37°C to an OD600 of 0.8–1.2 before inducing protein expression by addition of 0.4 mM isopropyl β-D-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Cell Biology 2024Quote: 500 ng of total RNA per sample were utilized as input for mRNA enrichment procedure with NEBNext® Poly(A) mRNA Magnetic Isolation Module (#E7490L, New England Biolabs, US) followed by stranded cDNA library generation using NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (#E7760L ...
-
bioRxiv - Cell Biology 2024Quote: ... All steps were performed as recommended in user manual E7760 (Version 1.0_02-2017; NEB), except that all reactions were downscaled to 2/3 of initial volumes.
-
bioRxiv - Cell Biology 2024Quote: ... using NEBNext Multiplex Oligos for Illumina – 96 Unique Dual Index Primer Pairs (#6440S, New England Biolabs, US). All generated cDNA libraries were amplified with 7 cycles of final PCR.
-
bioRxiv - Developmental Biology 2024Quote: ... DNA libraries underwent PCR amplification (NEB-Next High-Fidelity 2x PCR Master Mix, New England Biolabs), indexing using previously described primers (Buenrostro et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA libraries underwent PCR amplification (NEB-Next High-Fidelity 2x PCR Master Mix ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.4 U/ul RNAse Inhibitor (New England Biolabs), 0.2 U/ul SUPERase•In™ RNase Inhibitor (Invitrogen)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which the library amplification was one with Phusion High-Fidelity DNA Polymerase (New England Biolabs) during which the Illumina adapters were introduced ...