Labshake search
Citations for New England Biolabs :
2001 - 2050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL of Q5 High Fidelity Polymerase (New England Biolabs M0491L), 40.25 µL of nuclease-free water ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Genomics 2024Quote: ... Vector backbone pAC026 was subjected to a BstXI-BlpI (NEB R0585S) double digest at 37°C for 4 hr followed by SPRI purification ...
-
bioRxiv - Genomics 2024Quote: ... Digested oligo pool and vector backbone were ligated using T4 DNA Ligase (NEB) at room temperature for 45 min and purified using SPRI ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... extracted DNA was amplified using a two-stage Phusion High-fidelity DNA polymerase PCR (NEB). In a three-cycle PCR ...
-
bioRxiv - Genomics 2024Quote: ... This intermediate backbone (pJY127) was then digested with BamHI (NEB R0136S) and NotI (NEB R0189S) ...
-
bioRxiv - Genomics 2024Quote: Extracted samples were DNase treated (NEB, Ipswich, USA) to eliminate any residual DNA molecules from the host in the RNA extracts ...
-
bioRxiv - Genomics 2024Quote: ... Amplified oligo pool was double digested with BstXI and BsaI-v2 (NEB R3733S) restriction enzymes at 37°C for 4 hr and purified through column clean-up ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Immunology 2024Quote: ... TAP-PCR reaction was performed using 5 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... cDNA synthesis was performed using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and random hexamer primers ...
-
bioRxiv - Immunology 2024Quote: ... The following PCR primers were used to amplify cut sites with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA): IRF4 5’ - AGGTGCCTTCTTCCGGGG – 3’ & 5’ - TTGCGTGGAAACGAGAACGC – 3’ ...
-
bioRxiv - Genomics 2024Quote: ... Library amplification (10-12 PCR cycles) was carried out using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs), with IDT for Illumina UD Indexes (96x ...
-
bioRxiv - Genomics 2024Quote: ... A library for short-read sequencing was prepared using an NEBNext Ultra II DNA Library Prep kit (New England Biolabs, Beverly, MA) and sequenced using a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... 30 µL of the eluted DNA samples were mixed with 7 µL of TSO digestion mix (3.5 µL UDG-DNA glycosylase and 3.5 µL UDG Buffer, NEB M0280S) and incubated at 37 ºC for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genetics 2024Quote: ... and 0.1U Shrimp Alkaline Phosphatase (NEB).
-
bioRxiv - Genetics 2024Quote: ... DNA digested overnight with XhoI was further digested for ∼5 h with HF-BamHI or NgoMIV (New England Biolabs). Digested DNA was precipitated using standard ethanol/ sodium acetate precipitation.
-
bioRxiv - Genetics 2024Quote: ... Genome PCR products which were confirmed as a single band in AGE were subjected to direct Sanger sequencing after decomposing remaining nucleotides and primers by the treatment with 2U Exonuclease I (NEB) and 0.1U Shrimp Alkaline Phosphatase (NEB).
-
bioRxiv - Genetics 2024Quote: ... the slides were treated with 3 U/µl exonuclease III (New England Biolabs) in 1x NEB cutsmart buffer and incubated at 37°C for 15 min to digest nicked BrdU-positive strands ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA libraries were amplified using 1X NEBNext Ultra II Q5 Master Mix (New England Biolabs M0544), 1X EvaGreen dye (Biotium 31000) ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL rAlbumin (New England Biolabs B9200S), and 1 U/µL Phi29 DNA polymerase (Thermo Fisher Scientific EP0091) ...
-
bioRxiv - Genomics 2024Quote: ... and 100 µg/mL rAlbumin (New England Biolabs B9200S) in 1X PBS ...
-
bioRxiv - Genomics 2024Quote: ... 250 µM dNTPs (New England Biolabs N0447L), 200 µg/mL rAlbumin (New England Biolabs B9200S) ...
-
bioRxiv - Genomics 2024Quote: ... 50 nM dNTPs (New England Biolabs N0447L), 0.1 µM each padlock probe ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL rAlbumin (New England Biolabs B9200S), 0.4 U/µL RNase H (Enzymatics Y9220L) ...
-
bioRxiv - Genomics 2024Quote: ... 250 µM dNTPs (New England Biolabs N0447L), 1 µM each biotinylated reverse transcription primer (Integrated DNA Technologies) ...
-
bioRxiv - Genetics 2024Quote: ... no more than 5µg total RNA was treated with DNase I (NEB) for 30 minutes at 37°C then purified using RNA Clean & Concentrator -5 Kit ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transcription cDNA synthesis was performed using NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB, E6421). Samples were barcoded and the library pool was prepared according to the guidelines laid out in the Iso-Seq protocol version 02 (PacBio ...
-
bioRxiv - Genetics 2024Quote: ... coli 10β cells (New England BioLabs, C3019I). Following heat-shock ...
-
bioRxiv - Genetics 2024Quote: ... and the recommended protocol from NEB was followed ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplification was performed with Phusion or Q5 High Fidelity DNA Polymerase (New England Biolabs). Primer sequences are provided in Supplementary Table 4.
-
bioRxiv - Genetics 2024Quote: ... One microliter of oligo d(T)23VN primer (50 μM) (NEB) was added to 200 ng/µL of RNA (170 ng worm RNA + 35 ng yeast RNA ...
-
bioRxiv - Genetics 2024Quote: ... DNA fragments were assembled using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs (NEB)) using the pGEM-T easy plasmid backbone ...
-
bioRxiv - Genetics 2024Quote: The PCR reaction contents were mixed with 6x DNA loading dye (New England Biolabs, B7024S) and separated on 1% agarose gel prepared in Tris-acetate-EDTA buffer ...
-
bioRxiv - Genetics 2024Quote: ... DNA fragments were assembled using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs (NEB)) using the pGEM-T easy plasmid backbone ...
-
bioRxiv - Genetics 2024Quote: ... Mutant constructs were constructed using a Q5 site-directed mutagenesis kit from NEB. To introduce specific mutations into the constructs ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB) was used to clone the expression constructs ...
-
bioRxiv - Genetics 2024Quote: ... or twenty units of DPN1 enzyme (New England BioLabs, R0176L) at 37°C for 2 hrs ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR amplified products and cloning vector (pcDNA3.1) were digested to create compatible sites for ligation and transformed into NEB10 beta competent bacteria (NEB, Cat# C3019H). To create plasmids for chick electroporation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sox17 and sox32 deletion and domain switch constructs (Table S1) were generated using pCS2+sox17 and pCS2+myc-sox32 by PCR amplification using Q5 polymerase (NEB) using described primers (Table S2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... except for Sox17Δ7aa + Sox32 25aa and myc-Sox32ΔHMG + Sox17 HMG where NEBuilder HiFi DNA Assembly (NEB), with Sox17Δ7aa + Sox32 25aa as a gBlock (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 mM ribonucleoside vanadyl complex (New England Biolabs), and 2 mg/ml bovine serum albumin (Jackson ImmunoResearch) ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Genetics 2024Quote: ... and digested with the appropriate restriction enzyme (EagI for G541R or SacI for R433H, New England Biolabs). Digested PCR products were separated on a 1% agarose gel and analyzed to identify successful integration of the restriction site ...