Labshake search
Citations for New England Biolabs :
1151 - 1200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were treated with RNAse (100 μg/ml) at room temperature for 15 min and then with proteinase K (825 μg/ml, NEB™, P8107S) for 1 hour at 65°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... All PCR amplification for plasmid and vector constructions were performed using Q5 polymerase (New England Biolabs, Ipswich, MA). Most PCR reactions were performed using the following conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... then purified using a standard Monarch (New England Biolabs) column purification procedure ...
-
bioRxiv - Molecular Biology 2024Quote: ... The libraries were then prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (New England Biolabs, MA, USA) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2024Quote: ... The region after the TRR to the middle of exon 1 was amplified from 50 ng of gDNA using Phusion® High-Fidelity polymerase (New England Biolabs, M0530) according to the manufacturer’s instructions with the following primers ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs, M0253S) primed with random hexamers (Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... after adding an A-overhang with Taq DNA polymerase (New England Biolabs, M0273). Positive clones were selected and sequenced at the UC Berkeley Sequencing Facility.
-
bioRxiv - Genomics 2024Quote: ... and 400 U/µL of T4 DNA ligase (New England Biolabs M0202S). We observed that either 0.5:1 or 1:1 molar ratios of insert:backbone were optimal for library uniformity ...
-
bioRxiv - Genomics 2024Quote: ... All arrayed cloning was performed in NEB Stable chemically competent cells (New England Biolabs C3040H) according to the manufacturer’s recommendations and all cultures were grown at 30 °C ...
-
bioRxiv - Genomics 2024Quote: ... Entry vectors were digested with BsmBI-v2 (New England Biolabs R0739L), dephosphorylated with rSAP (New England Biolabs M0371L) ...
-
bioRxiv - Genomics 2024Quote: ... of entry vector and 2 ng of gene fragment were assembled in a 2.5 µL reaction of 1X T4 DNA ligase buffer (New England Biolabs B0202S) and 1X BsmBI-v2 Golden Gate Enzyme Mix (New England Biolabs E1602S ...
-
bioRxiv - Genomics 2024Quote: ... Amplified oligo libraries were digested with BsmBI-v2 (New England Biolabs R0739L) and purified with the QIAquick PCR & Gel Cleanup Kit (Qiagen 28506) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was then ligated to adaptors at the 3’ end by NEB 3’ SR adaptor and 5’ end by T4 RNA ligase ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI; NEB catalog #R0146). The digested genomic DNA was resolved on a 1% ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI ...
-
bioRxiv - Genomics 2024Quote: ... RNA-seq libraries were then constructed using the NEBNext Ultra II RNA Library prep for Illumina kit (NEB#E7760L) NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2024Quote: ... the libraries were firstly constructed using the NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB). Total RNA was then ligated to adaptors at the 3’ end by NEB 3’ SR adaptor and 5’ end by T4 RNA ligase ...
-
bioRxiv - Molecular Biology 2024Quote: ... The hairpins within the adaptors were digested with USER (NEB, catalog #M5505), and the DNA was amplified with Illumina TruSeq primers and barcodes ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-seq libraries were constructed using the NEB Next® UltraTM Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were added to 30 μl pre-equilibrated amylose resin (E8021S, NEB), and incubated for another hour rotating at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% Igepal CA-630) were incubated with 20 μl of amylose resin (E8021S, NEB), pre-equilibrated in buffer J for 30 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested with MluI using Gibson Assembly (NEB), yielding the final vector pLPG-GFP-AID (5’ BlastR-P2A-eGFP-AID-3C).
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL of reactions were treated with 2 µL DNase I (NEB, Cat # M0303S) in a total volume of 100 µL at 37°C for ∼ 20 min before further analysis and treatment.
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq libraries were constructed using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England BioLabs) using ChIP products from “OSC ChIP” and “Ovary ChIP” ...
-
bioRxiv - Molecular Biology 2024Quote: ... upon which half of the samples were treated with 1U (0.1 µl) of T7 Endonuclease I (New England Biolabs), which cleaves branched DNA structures ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR product was digested by EagI (New England Biolabs) and ligated into FMR1 RNA construct backbone instead of 5’UTR of FMR1 sequence using T4 ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... and DNA end-repaired with 1X T4 DNA ligase buffer (New England Biolabs), 0.4 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dephosphorylation of DNA ends was performed by addition of 5 μl rSAP (NEB, #M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37° C for 2 hrs from 1 µg purified dsDNAs using a T7 high yield RNA synthesis kit (NEB, Cat # E2040S) in a total volume of 20 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% Igepal CA-630) and incubated with 30 μl of amylose resin (E8021S, NEB), pre-equilibrated in buffer I ...
-
bioRxiv - Molecular Biology 2024Quote: RT-qPCR was performed (in triplicate) using the Bio-Rad cycler CFX 96 and the Luna universal qPCR master mix (NEB, M3003X). Gene expression levels were normalized to housekeeping genes EF1 ...
-
bioRxiv - Genomics 2024Quote: ... MboI restriction enzyme (NEB, R0147M) was added and chromatin was digested at 37°C for 5 hr ...
-
bioRxiv - Genomics 2024Quote: ... and Ligation Module (NEB, E7445L) following the operation manual ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: ... the products were used to generate RNA transcripts using the HiScribe T7 In Vitro Transcription Kit (NEB, E2040S) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB) (Smola et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... 1μL RNase inhibitor (NEB, M0314L), 0.8μL Maxima H RT Enzyme (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... A 245 bp region flanking the rs2553628 variant was PCR amplified from PACG patient genomic DNA and directionally cloned into the multiple cloning site upstream of the firefly luciferase cassette using KpnI and XhoI restriction enzymes (NEB) in the pGL4.20 luciferase construct driven by an SV40 promoter (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Site-directed mutagenesis primers were designed using NEBasechanger and implemented through Q5 Site-Directed Mutagenesis (NEB, Cat #E0554S). For the cytoplasmic split-ubiquitin protein-protein interaction system ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic region of interest were firstly amplified by PCR (Q5-NEB), and the products were purified using the DNA Clean & Concentrator kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2024Quote: ... the vector was linearized by double digestion using restriction enzymes (New England Biolabs). DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs) ...
-
Modular structure of RNA 3’ processing condensates involving the Arabidopsis RNA binding protein FCAbioRxiv - Molecular Biology 2024Quote: ... NdeI and XbaI (NEB) overnight ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we added 1 uL of T4 DNA ligase buffer (New England Biolabs, USA, product #B0202S). Using a thermal cycler (C1000 Touch Thermal Cycler ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 50 U of Exonuclease III (#M0206L, NEB) was added to each reaction and incubated at 37°C for 45 minutes ...