Labshake search
Citations for New England Biolabs :
1351 - 1400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... according to the manufacturer’s instructions (NEB, E6300, www.neb.com). qPCRs were done using qPCR Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Phusion® HF DNA polymerase (NEB, USA) was used for all amplification steps ...
-
bioRxiv - Plant Biology 2024Quote: ... The pJET_ZEP3-NosT plasmid was digested with AvrII and SbfI restriction enzymes (NEB). These were then ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Linearization of the homology donor and pKS diaCas9_sgRNA plasmids were performed by KpnI-HF® and NdeI (NEB) restriction enzymes respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... and GFP-HSPTerminator amplicon from pMod_C3003 vector were amplified by PCR and assembled by using NEB HiFi assembly master mix (E2621S, NEB, USA). Later ...
-
bioRxiv - Plant Biology 2024Quote: ... 240 μl of oligo(dT) bead slurry (New England Biolabs, Frankfurt, Germany) were washed three times in 1 mL of lysis buffer (20 mM Tris-HCl pH 7.5 ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, #E7103) according to the manufacturer’s instructions ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... RNA library preparation was performed using the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB #E7775) or the SMRTbell Prep Kit 3.0 for Illumina and Iso-Seq respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Site-directed mutagenesis was performed using Q5 High Fidelity DNA Polymerase (New England Biolabs). The NanoLuc expressing plasmid was provided by PhoreMost Ltd (Cambridge ...
-
bioRxiv - Cell Biology 2024Quote: Homo sapiens cDNAs were amplified by PCR using Q5 High Fidelity DNA Polymerase (New England Biolabs) and sub-cloned into a variety of vector backbones as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Immunology 2024Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR amplification was done using Phusion® High Fidelity DNA Polymerase (NEB) with an annealing temperature of 60°C and an extension time of 30 seconds ...
-
bioRxiv - Plant Biology 2024Quote: ... and the NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Cat. No. E7335S). Size selection was aimed at 300-400 bp fragments ...
-
bioRxiv - Neuroscience 2024Quote: ... and EcoR1 (New England Biolabs, Frankfurt a.M., Germany) restriction sites ...
-
bioRxiv - Plant Biology 2024Quote: ... F4 was first dephosphorylated by incubating with calf intestinal phosphatase (NEB) for 2 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The filtered lysate was passed over a gravity-flow column packed with 0.5 ml amylose resin (New England Biolabs) that had been pre-equilibrated with extraction buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... using a NEBNext® single cell/low input cDNA synthesis and amplification kit (E6421L) which uses a template switching method to generate full length cDNAs (New England BioLabs, Ipswich, MA, USA). IsoSeq libraries were prepared from the cDNA according to standard protocols using the SMRTbell v3.0 library prep kit (Menlo Park ...
-
bioRxiv - Plant Biology 2024Quote: ... dephosphorylated F4 (5 µM) was incubated with γ-[32P]-ATP and T4 polynucleotide kinase (NEB) for 45 min at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The Z. tritici codon-optimized GFP was amplified from pCeGFP (Kilaru et al. 2015) using NEB Phusion polymerase (New England Biolabs) and the primers listed in Supporting Information Supplementary Table S2 ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Neuroscience 2024Quote: ... and then washed with 0.1x SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L) (NEB, M0314L). RNA released from the permeabilized tissue and captured by the DNB was reverse transcribed overnight at 42°C using SuperScript II (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated at 37°C for 5 minutes, and then washed with 0.1x SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L) (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... using BamH1 (New England Biolabs, Frankfurt a.M., Germany) and EcoR1 (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... the HpaI or ApaLI (New England Biolabs) linearized pENTR of attL1-UBIpro::GFP/AtRACK1a/NtRACK1-PafA::terHSP-attL2 and attL1-UBIpro/CC1pro::PafA-CC1::terHSP-attL2 were integrated into pMDC32_35S::FLAG-Pup(E)::ter3A::attR1-attR2::terNOS respectively through LR reactions.
-
bioRxiv - Plant Biology 2024Quote: ... Backbones and fragments were assembled with NEBuilder® HiFi DNA assembly mix (New England Biolabs) / In-fusion Master mix (Takara ...
-
bioRxiv - Neuroscience 2024Quote: Deglycosylation of total brain homogenates was performed according to the PNGase F kit instruction manual (#P0704S, New England Biolabs). 40µg of protein were digested with 1,000 U of PNGase F enzyme.
-
bioRxiv - Pathology 2024Quote: ... NEB Next Poly(A) mRNA Magnetic Isolation Module (NEB) kit was used to enrich the poly(A ...
-
bioRxiv - Neuroscience 2024Quote: ... and prepared using NEBNext Ultra II Directional RNA Library Prep Kit with Sample Purification Beads (E7765; New England Biolabs, Ipswitch, MA). cDNA libraries were then indexed using the NEBNext Dual Index Kit (E7600S ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA sequencing libraries were enriched for mRNA with the NEBNext® Poly(A) mRNA Magnetic Isolation Module (S7590S; New England Biolabs, Ipswitch, MA) and prepared using NEBNext Ultra II Directional RNA Library Prep Kit with Sample Purification Beads (E7765 ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were then indexed using the NEBNext Dual Index Kit (E7600S; New England Biolabs, Ipswitch, MA). Final cDNA libraries were analyzed by DNA ScreenTape Analysis on an Agilent 4200 TapeStation per the manufacturer’s protocol to determine library size ...
-
bioRxiv - Neuroscience 2024Quote: ... The NEBNext Ultra End Repair/dA-tailing Module (New England Biolabs; Ipswich, MA) was used for end repair and A-tailing of the isolated ...
-
bioRxiv - Neuroscience 2024Quote: ... Cloning was done using Gibson Assembly Master Mix (NEB) and the resulting products were cleaned up using SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... or amylose resin (NEB). The in vitro phosphorylation assay was performed using proteins purified from maize seedlings or protoplasts or 2 µg recombinant proteins as kinases and 5-10 µg universal substrate MyBP or recombinant proteins as substrates ...
-
bioRxiv - Molecular Biology 2024Quote: ... DSBs were blunted with exonuclease VII (NEB, catalog # R0630) and exonuclease T (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and exonuclease T (NEB, catalog # M0625). Blunt ends were A-tailed and capped with END-seq adaptor 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and/or PmeI (NEB, catalog #’s R0630 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plugs were melted at 70°C and treated with ý-Agarase I (NEB, catalog #M0392) to liberate the DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked RNA fragments were dephosphorylated at their 3’ ends using T4 Polynucleotide Kinase (New England Biolabs, M0201S) and ligated to a pre-adenylated 3’ adapter (L3-App) ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids below 10kb in size were constructed through PCRs and subsequent Hifi assembly (NEB E2621S), according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... provided by New England Biolabs (NEB). For all conjugation experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pTra_ΔtraST were constructed using pBeloBAC11 (NEB) as plasmid backbone ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA sequencing libraries were prepared using the NEB Next Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Isolated plasmids were prepared for transformation by linearizing with EcoRI restriction enzyme according to the supplier’s instructions (NEB, Ipswich, MA, The US).
-
bioRxiv - Molecular Biology 2024Quote: ... 173 bp TBR-PCR target products were excised and purified using an Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, Ipswich, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... was linearised with 100 U of Bbs I-HF (NEB) for 2 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... using T4 DNA ligase (NEB). To generate intein-split ABE plasmids for AAV production ...
-
bioRxiv - Neuroscience 2024Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB). All plasmids were transformed into Escherichia coli Stable3 competent cells (NEB) ...