Labshake search
Citations for New England Biolabs :
951 - 1000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... RNA libraries were constructed utilizing the NEBNext® Ultra RNA Library Prep Kit for Illumina (NEB, E7530L) and sequenced on an Illumina NovaSeq 6000 PE150 platform using the 150-bp pair-end sequencing parameters (Novogene ...
-
bioRxiv - Microbiology 2024Quote: The amplicons were integrated into SmaI (New England BioLabs)-digested vector using the GeneArt Gibson Assembly HiFi Master Mix (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: The rsmA gene was PCR amplified using Phusion polymerase (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2024Quote: ... which had previously been linearized and digested with the restriction enzyme Dpn1 (New England Biolabs). Purification products of the first CHIKV fragment ...
-
bioRxiv - Microbiology 2024Quote: ... the product of the digestion reaction was dephosphorylated by the Quick CIP (New England Biolabs). For ligation of the vector and the PCR product ...
-
bioRxiv - Microbiology 2024Quote: ... sialidase (α2-3,6,8 Neuraminidase, New England BioLabs Inc. Ipswitch, MA.) was diluted 2-fold in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... pyrogenes was carried out according to manufacturer’s instructions (NEB #M0386) with 30 nM sgRNA and 3 nM substrate DNA final concentrations.
-
bioRxiv - Microbiology 2024Quote: ... The PCR product and the vector were enzyme-digested using NdeI and XbaI (New England Biolabs) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... either using the Quick-Load Taq2X Master Mix enzyme (NEB, M0271S), or with the Q5 Hot Start High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... or with the Q5 Hot Start High-Fidelity DNA polymerase (NEB, M0493S) and the addition of GC enhancer to aid in the amplification of GC-rich segments ...
-
bioRxiv - Microbiology 2024Quote: nfsA and nfsB genes were amplified with Phusion high-fidelity DNA polymerase (NEB, UK) from various E ...
-
bioRxiv - Microbiology 2024Quote: nfsA and nfsB mutants were constructed by gene inactivation using the pKNOCK suicide plasmid (22) The DNA fragments were amplified with Phusion high-fidelity DNA polymerase (NEB, UK) from E ...
-
bioRxiv - Microbiology 2024Quote: ... and adapter sequences with unique indexes were inserted with 15 cycles of PCR using NEB Next single index adapters (New England BioLabs). Purified PCR products were measured and pooled for sequencing on an Illumina NextSeq 550 High Output Flow Cell using the single-end 75 base technique using AMPure XP SPRI beads (Beckman Coulter Life Sciences).
-
bioRxiv - Molecular Biology 2024Quote: ... 3 uL RNase A and 1 uL ProtK all from the Monarch gDNA extraction kit (NEB, T3010). gDNA was extracted following the extraction kit’s protocol with the exception that 600 uL of gDNA binding buffer were added to 400 uL quenched reaction and added to the extraction column on two spins of 2 minutes at 1000g ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF254, cTF255) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Initial test concentrations were adapted from NEB kit manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified DNA was amplified by Q5 high-fidelity DNA polymerase (NEB) with a universal i5 primer and a uniquely barcoded i7 primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II kit (NEB E7645) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The eluent was mixed with 10 U of Bst 2.0 WarmStart DNA polymerase (NEB) and 1 × Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then used as input for the NEBNext Ultra II RNA Library Prep Kit (NEB #E7770S). Sample preparation was performed as per manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 ng of purified RNA for each sample was enriched for polyadenylated mRNA with the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and then used as input for the NEBNext Ultra II RNA Library Prep Kit (NEB #E7770S) ...
-
bioRxiv - Cell Biology 2024Quote: ... the library was digested with the restriction enzyme Dpn I (New England BioLabs), which possesses specificity for methylated 5’-GmATC-3’ sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... G or C) and assembled using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The randomized N12-oligonucleotides were commercially synthesized and purified on a reversed-phase column (FASMAC ...
-
bioRxiv - Cell Biology 2024Quote: ... previously linearized using the Scal restriction enzyme (NEB). The cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 μl Q5 DNA Polymerase (NEB #M0491) and 15.75 μl ultrapure water was prepared and mixed with 1 μl of cDNA solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 U T4 RNA ligase 2 (truncated KQ, NEB) and 40 U Murine RNase Inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 U Murine RNase Inhibitor (NEB), 0.75 μg Zebrafish tRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 40 U Murine RNase Inhibitor (NEB) for 4 hours at 25 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X Protoscript II buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2) 40 U Murine RNase Inhibitor (NEB), 5 mM DTT and pre-incubated for 10 minutes at 42 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μg/ml BSA) (12) and 40 U Murine RNase Inhibitor (NEB). Aliquots were withdrawn after 3 and 30 minutes at 25 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of 4 µl circularized cDNA was performed in a reaction volume of 48 μl in the presence of 500 nM PCR forward primer (AATGATACGGCGACCACCGAGATCTACA*C, where * is a phosphorothioate bond) and indexed NEBNext® Multiplex Oligoes for Illumina (NEB), 0.48 U KAPA HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 40 U Murine RNase Inhibitor (NEB), followed by PCI extraction and ethanol precipitation.
-
bioRxiv - Cell Biology 2024Quote: ... mSc-dnKASH was amplified from pCMV-mSc-dnKASH and pEF-mSc-dnKASH was generated using the Gibson cloning technique (NEB) with the following primers (5’ → 3’) ...
-
bioRxiv - Cell Biology 2024Quote: ... Fragments were Gibson assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621S). Whole plasmid sequencing was performed by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation.
-
bioRxiv - Cell Biology 2024Quote: ... Fragments were Gibson assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621S). Whole plasmid sequencing was performed by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation.
-
bioRxiv - Molecular Biology 2024Quote: ... and processed with NEBNext End Repair and dA-Tailing Modules (NEB), and ligated to methylated Illumina Adaptors using NEBNext Quick Ligation Module (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Phusion polymerase (NEB, M0530S) was employed for this process ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products were gel-purified with Monarch DNA Gel Extraction Kit (NEB) and used for the ligation reactions ...
-
bioRxiv - Developmental Biology 2024Quote: ... linearized with BsaI (New England Biolabs, Japan), was ligated with double-stranded DNA (Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SnaBI (NEB), to excise out the upstream region of EF1α ...
-
bioRxiv - Developmental Biology 2024Quote: ... EF1α>Cas9 (addgene59987) (Stolfi et al., 2014) was digested with NheI (NEB) and SnaBI (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and screened by colony PCR with OneTaq Quick-Load 2X Master Mix (NEB). Positive colonies were cultured overnight (o/n ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL 1U recombinant shrimp alkaline phosphatase (NEB) and 2.5 µL 10x CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were constructed by PCR with the index primers for the EM-seq kit (NEB) with NEBNext Q5U Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... methylated gDNA was sonicated to an average length of 400 bp using a Covaris E220 Focused-Ultrasonicator and combined with the methylated pUC19 and the unmethylated lambda-phage DNA (NEB). End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... with NEBNext Q5U Master Mix (NEB) using the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...