Labshake search
Citations for New England Biolabs :
1101 - 1150 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Genetics 2021Quote: Vector backbones were obtained by restriction digest and component parts for vector inserts were generated by PCR from synthesised DNA or existing vector templates using Q5® High-Fidelity 2X Master Mix (NEB). Vector components were purified using the Monarch® DNA Gel Extraction Kit or the Monarch® PCR & DNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... A screen for clones containing an insert into pBAD33 was carried out using 1 μl of this suspension as a PCR template using primers oMJD204 and oMJD205 and OneTaq Quickload 2X Master Mix (NEB, #M0486S), according to the manufacturer’s instructions (annealing temperature 45 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA substrates for in vitro cleavage represent fragments of human mitochondrial DNA amplified by PCR in Q5® High-Fidelity 2X Master Mix (M0492L, NEB). As a template ...
-
bioRxiv - Genomics 2020Quote: Primer-walk PCRs were performed with edited single-cell clones to identify aberrant PCR products with OneTaq 2x Master Mix (NEB M0486L) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and pre-amplified by PCR in the presence of adapter primers (NEBNext 2x PCR Master Mix, New England Biolabs Inc. #M0541S). Amplification was monitored by RT-PCR using the PowerUp™ SYBR™ Green Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... was amplified as per the ChIPmentation protocol [64] using indexed and non-indexed primers and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541) in a thermomixer with the following program ...
-
bioRxiv - Genomics 2019Quote: ... After that tagmended library (20 µL) was PCR amplified using 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, #M0541L), 2.5 µL of P5_BRB primer (5 µM ...
-
bioRxiv - Immunology 2019Quote: ... The ITS2 region was amplified and Illumina adapters appended by PCR in 25 ul volume with Q5 High-Fidelity 2X master mix (NEB, # M0492L). PCR conditions were as follows ...
-
bioRxiv - Genomics 2019Quote: ... flanking the crRNAs cutting sites of Slit2 locus and pUC empty vector were amplified by Q5® Hot Start High-Fidelity 2X Master Mix (Cat. M0494S, NEB) from mouse tail genomic DNA and pX330 plasmid (Cat ...
-
bioRxiv - Immunology 2020Quote: ... Target DNA was amplified from a cDNA template or existing plasmids using primers and PCR conditions shown in Tables S2-S4 using Q5 High-Fidelity 2X Master Mix (New England Biolabs # M0494L). Primers were ordered with 5’ base extensions that overlapped expression vectors on either side of the restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... REV: TTACTTCGCTGTCATCATTTGTACAAACTCTTCGTAG) pEntry_GCaMP5G was linearized with PCR reaction using standard Phusion® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was used to construct high-throughput sequencing libraries using NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs M0541). DNA libraries were processed on a Illumina NextSeq machine for paired-end 41-nt sequencing ...
-
bioRxiv - Genomics 2021Quote: ... 5.25 mg of genomic DNA (gDNA) was used as template across 525 x 100 µL PCR reactions using Q5 2X Master Mix (NEB, M0492L). For the distal sub-library screens ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL P7 primer (10 μM) (5ʹ-CAAGCAGAAGACGGCATACGAG AT[i7] GTCTCGTGGGCTCGG-3ʹ; IDT) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541). Amplification was performed using the following program ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was performed with 10 ng of plasmid DNA template using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in a final reaction volume of 25 μL according to the manufacturer’s recommendations except that the extension time was set to 80 seconds per kb for a total of 20 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50-100 ng of gDNA was amplified in 50 µl reaction using Q5® Hot Start High-Fidelity 2X Master Mix (New England BioLabs) with initial denaturation at 98°C for 30 sec followed by 35 cycles of 98°C 10 sec ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Microbiology 2021Quote: ... the ARTIC nCoV-2019 V3 Primer set (IDT) and the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat#M0494S) were used with modified manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... LAMP (Loop-Mediated Isothermal Amplification) reactions were performed with WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) (New England Biolabs) and an alternative set of primers (Supplementary Table S3) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: PCR amplification of the cloning inserts was done using Q5 High-Fidelity 2X Master Mix (NEB, Ipswich, MA, catalogue no. M0492L). 20 μL reactions were prepared by dispensing 1 μL of each 10 μM reverse primer into the wells of a 96-well PCR plate using the Echo liquid handler (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... was cloned into the pCDH lentivector with PCR fragments amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genomics 2020Quote: ... Cell lines were regularly tested for mycoplasma contamination and confirmed negative with PCR (NEB NebNext Q5 High Fidelity 2X Master Mix).
-
bioRxiv - Developmental Biology 2021Quote: ... The template for probe synthesis was generated through two rounds of standard PCR method using OneTaq® 2x Master Mix (New England Biolabs, NEB): the first PCRs from cDNA used the gene-specific primers including the T7 linker sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... Between 1-2kb of flanking regions upstream and downstream of the region of interest were amplified from parental strain using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Developmental Biology 2022Quote: ... TE buffer (20 µL) was added and PCR was performed using NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs, M0541) as follows ...
-
bioRxiv - Genomics 2022Quote: ... The DNA substrates for in vitro cleavage assays were synthesized using Phusion® Hot Start Flex 2X Master Mix (NEB, M0536S) and purified using GeneJET PCR Purification Kit (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... we used the aforementioned primers M13/pUC Forward and L4440 Reverse and the isolated plasmid (template) in a OneTaq® 2X Master Mix with Standard Buffer (NEB) reaction as recommended by the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... Transformants and chromosomally engineered Pseudomonas were screened by colony PCR using OneTaq 2x Master Mix (New England Biolabs, Ipswich, MA, USA). The cell material was lysed in alkaline polyethylene glycol for enhanced colony PCR efficiency as described previously (31).
-
bioRxiv - Synthetic Biology 2020Quote: ... was then PCRed using P5 and a barcoded version of SGR-176 (see Table S2) the Q5 Hot Start High Fidelity 2x Master Mix (NEB, M0492L) with the following settings ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... the ARTIC nCoV-2019 V3 Primer set (IDT) and the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat#M0494S) were used with modified manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Microbiology 2020Quote: The middle dsDNA fragment containing the erm cassette flanked by FRT sites and the randomized barcode was obtained by PCR with Phusion Hot Start Flex 2X master mix (NEB; M0536L) and pHB1 as template ...
-
bioRxiv - Genomics 2021Quote: NGS libraries were generated by amplifying the CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (Buenrostro et al., 2015) (Supplementary Table 6) with NEBNext® HiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Genetics 2019Quote: ... DBT1 loci were first amplified with 17 cycles of PCR using a touchdown protocol and the NEBnext 2x master mix (New England Biolabs M0541). The resulting product served as input to a second PCR ...
-
bioRxiv - Microbiology 2019Quote: ... Between 1-2kb of flanking regions upstream and downstream of the regions of interest were amplified from parental strains using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplifications were done in 5 μL volumes in a 384-format PCR plate using Q5® Hot-Start High-Fidelity 2x Master Mix (New England BioLabs, 2.5 μL per reaction for 1x concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2019Quote: ... The 3-part assembly reaction (plasmid-promoter-insert) was performed using the Gibson assembly master mix 2x (New England Biolabs #E2611S), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: RT-LAMP reactions were performed using either WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) (M1800) or WarmStart® LAMP Kit (DNA & RNA) (E1700) from New England Biolabs (NEB). 40 mM guanidine hydrochloride was included in all reactions to improve LAMP reaction speed and sensitivity [10] ...
-
bioRxiv - Microbiology 2021Quote: ... tPCR reactions for each target were performed in a 50 μl volume consisting of 25 μl LongAmp® Taq 2X Master Mix (NEB), 200 nM each of tPCR primers and 100 ng DNA template as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of 10 mM indexed P5 and P7 primer solutions and 25 µL NEBnext High-Fidelity 2X Master Mix (New England BioLabs: ME541L) were added ...
-
bioRxiv - Molecular Biology 2022Quote: ... were used to amplify these dsRNA-complementary sequences from Drosophila genomic DNA with the Q5® Hot Start High-Fidelity 2X Master Mix (NEB). The PCR product was precipitated in 1 volume isopropanol and 1/10 3M sodium acetate for 5 min at room temperature ...