Labshake search
Citations for New England Biolabs :
1051 - 1100 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... targeting the desired histidine residues and used them to amplify the gene of interest using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs). After PCR amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... The 25-μl reactions contained: 12.5 μl Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, United Kingdm), 1.25 μl forward primer (10 μM) ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA barcodes were amplified from genomic DNA using universal primers JSW-SS-170 (CGACGCTCTTCCGATCTNNNNN TGATGTCGTTGTTGCCATCG) and JSW-SS-171 (ACTGACGCTAGTGCATCA CTTTCTGAGCCAGTGTTGCT) and the Q5 Hot Start High-Fidelity 2X PCR master mix (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Entire DNA sample was amplified in several 30 cycle reactions using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), the amplicons were digested with DpnI (thermo scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25 µM of forward and reverse primers mixed in a final volume of 25 µl reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: The circularized cDNA (1 µL) was amplified by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB M0494L) in a 25 µL reaction containing 12.5 pmoles of forward and reverse primers (primers listed in Supplementary Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... All PCR reactions were performed in 50 μL reactions using Q5 High-Fidelity 2X Master Mix (New England Biolabs, M0492L). Primers for genomic DNA amplification are included in Table S2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... where X is the unique Nextera barcode used for sequencing and 25 μl of NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs) using the following thermocycler program ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Developmental Biology 2024Quote: ... bulk-extracted genomic DNA from these strains was used to set up PCR reactions for each primer set using Quick Load Taq 2X Master Mix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... 1 µL of sample from an individual cDNA reaction was mixed with 12.5 µL of 2x Q5® High-Fidelity Master Mix (New England Biolabs), 0.5 µL of each primer (0.2 µM final concentration of each primer) ...
-
bioRxiv - Immunology 2024Quote: ... 10 ng of restriction enzyme digested backbone and 20 ng of SPRI purified PCR variable regions were combined with an appropriate volume of 2x HiFi master mix (New England Biolabs) for one hour at 50°C ...
-
bioRxiv - Bioengineering 2024Quote: ... input genomic DNA was amplified in a 10-μl reaction for 26 cycles using NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR products were purified using Sera-Mag magnetic beads (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Microbiology 2024Quote: ... 800 bp-long sequences located upstream and downstream of the Vc flagellins were amplified with Q5 2X master mix (New England Biolabs) and ligated into the restriction site XhoI and SphI in pDM4 followed by transformation of the plasmid into E ...
-
bioRxiv - Neuroscience 2024Quote: ... The final cDNA sample was then split into 16 separate reactions for final PCR amplification using 16 unique Illumina indexing primers and Q5 Hot Start High-Fidelity 2X Master Mix (NEB). After amplifications ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 ng cDNA was utilized as a template for amplification of RLN1 and RLN2 using Hot Start Taq 2X Master Mix (New England Biolabs) and GeneAmp PCR System 2700 thermal cycler (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... Capsid library cDNA was then amplified in multiple 50-µL PCR reactions unsing Q5 HotStart high-fidelity 2X master mix (NEB).
-
bioRxiv - Microbiology 2024Quote: ... Primers with overhanging sequences homologous to either 5’ or 3’ end of target gene fragments were used to linearize pMCSG53 expression vectors at the multiple cloning sites through PCR reactions (Q5 High-Fidelity 2X Master Mix, New England Biolabs). Amplicons were subsequently gel-extracted (Wizard SV Gel and PCR Clean-Up System ...
-
bioRxiv - Microbiology 2024Quote: ... On-bead PCR indexing-amplification was performed using custom-ordered indexing primers (IDT) matching the Illumina Nextera Index Kit sequences and 2x Phusion Master Mix (NEB). PCR reactions were amplified for 9-11 cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... Digested backbone plasmid and annealed spacer sequences were assembled using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs) in a reaction containing 5 µl of the master mix 2 µl of the digested backbone and 3 µl of the PCR annealed spacer ...
-
bioRxiv - Bioengineering 2024Quote: ... All PCR amplifications were performed using the Q5® High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... And cloned into a expression plasmid under the control of the EF1α using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs). To generate 3’ and 5’ stop codon reporters ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were immediately purified using a Qiagen minElute column and subjected to PCR amplification with NEBNext High-Fidelity 2X PCR Master Mix (NEB). Optimal PCR cycles were determined via qPCR to avoid over-amplification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were generated by amplifying sgRNA sequences from genomic DNA using bar-coded Illumina-compatible adapter-containing primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). PCR products were pooled and purified with a ZymoSpin V column with Reservoir (Zymo Research) ...
-
bioRxiv - Genetics 2022Quote: 12.5 μL 2X LAMP mix (New England Biolabs Cat # E1700S or M1800S for colorimetric readout)
-
bioRxiv - Cell Biology 2020Quote: ... Gibson Assembly Master Mix (NEB) was used to clone the PCR product into lentiCRISPR v2 plasmid(Sanjana et al ...
-
bioRxiv - Plant Biology 2020Quote: ... 1X OneTaq master mix (NEB), 0.2uM primers and 3.0 uM MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... Purified fragments were then introduced into the pMTLSC7315 ΔMCS by Gilson Assembly® Master Mix (Biolabs) giving the plasmid pDIA6464 (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: Master Mix (New England Biolabs). The resulting plasmid was named pMMBpLlacO-1-67EH-yfp ...
-
bioRxiv - Immunology 2023Quote: ... NEBridge Ligase Master Mix (NEB), and the cloning backbone containing PaqCI sites (Figure 1b) ...
-
bioRxiv - Immunology 2023Quote: ... 25ul Phusion master mix (NEB) and 2ul of each barcoded PCR primer (ApexBio ...
-
bioRxiv - Cancer Biology 2023Quote: ... SYBR™ green and 0.5 µM of sample-specific P5/P7 barcoded primer mix (New England Biolabs). Bead clean-up and purification was performed using SPRI beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Developmental Biology 2019Quote: ... three biological replicates for each genotype were amplified in technical triplicate using Luna Universal qPCR Master Mix (NEB) on an Applied Biosystems StepOne Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-PCR reactions were carried out using Luna Universal qPCR Master Mix (New England Biolabs, https://www.neb.ca) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Each reaction consisted of 10 μl of Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA), 5 μl of standard or sample ...
-
bioRxiv - Microbiology 2020Quote: ... at final volume 20 μL with 10 μL of Luna Universal qPCR Master Mix (New England Biolabs, Germany). The concentration of the primers varied from 0.2-0.5 μM (for further details regarding genes ...
-
bioRxiv - Immunology 2020Quote: ... Quantification of all other transcriptos was performed using the Luna® Universal qPCR Master Mix (New England BioLabs), on a CFX384™ Real-Time System (BIO-RAD) ...
-
bioRxiv - Genetics 2020Quote: ... CD19 gRNA expression in various organs was quantified using Luna® Universal qPCR Master Mix (NEB, Cat: M3003S). The Actinb transcript served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... quantification of relative mRNA levels of target genes was performed using the LunaR Universal qPCR Master Mix (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pif expression was assessed with the Luna® Universal Two-Step RT-qPCR Master Mix (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Twenty microlitre reaction mixtures were prepared using the Luna® Universal qPCR Master Mix kit (New England Biolabs) as follows ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using Luna universal QPCR mix (NEB # M3003) in the CFX96 Real-Time PCR system with a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 ng of plasmid DNA was used per PCR reaction and used in a volume of 50 µl using Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol) ...
-
bioRxiv - Immunology 2021Quote: ... was isolated from cDNA of devil peripheral blood mononuclear cells (PBMCs) by PCR using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...