Labshake search
Citations for New England Biolabs :
1001 - 1050 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... Integration of the sequences and removal of sacB gene was confirmed by colony PCR (SI Fig 2) with OneTaq Hot Start Quick-Load 2X Master Mix with GC buffer (New England BioLabs) using a Touchdown thermocycling protocol with an annealing temperature ranging from 72-62°C ...
-
bioRxiv - Genetics 2020Quote: ... and inserted into the pET28a plasmid between the EcoRI and XhoI restriction sites using 2X HiFi DNA Assembly Master Mix (New England Biolabs) to create pET28a-SaCas9-KKH ...
-
bioRxiv - Genetics 2021Quote: ... Amplification of products for next-generation sequencing was conducted with Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs). All DNA oligonucleotides used in this study were obtained from Integrated DNA Technologies ...
-
bioRxiv - Genomics 2020Quote: ... 150 ng of RoC-ITS product and splint DNA are combined with 10μl of Gibson Assembly 2X Master mix (Catalog number: E2611S Vendor: New England Biolabs Inc), and are incubated at 50°C for 60 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 100ng of cDNA is circularized using 100ng of a DNA splint (Table S8) and 2x NEBuilder HiFi DNA Assembly Master Mix (NEB). This mix was incubated at 50C for 60 minutes ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were carried out as described above (25 μL total volume, Q5 hot start high fidelity 2X master mix [New England Biolabs] ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 PCR2 reactions were used per timepoint with 5 μL of PCR1 product amplified with 25 μL Q5 High Fidelity 2X Master Mix (NEB), 5 μL of 10 μM primer mix in 50 μL volume using the following PCR protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 200-275 base pair region containing the relevant sgRNA target sequence was PCR-amplified from genomic DNA using the NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs) in a 25 µL PCR reaction volume (primer sequences appear below) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplification was carried out using NEB Q5 High Fidelity 2x Master Mix (New England Biolabs Inc., Ipswich, Massachusetts, USA). The PCR reaction consisted of 2.5 ul each of 10 μM Forward and Reverse Primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR fragments were generated using oligonucleotides ordered from Integrated DNA Technologies (IDT) and Q5 High Fidelity DNA Polymerase 2X master mix (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Promoter regions were PCR amplified from S2 cell genomic DNA using primers containing gibson overhangs corresponding to the BglII and HindII restriction sites on pGL3 with Q5 high-fidelity 2x master mix (NEB). PCR products were cleaned with AMPURE beads and eluted in water ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Cancer Biology 2022Quote: PCR products were amplified from the specified genomic DNA samples with Q5 High-Fidelity 2X Master Mix (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... A 4699 bp HDR template dsDNA (HDRT) was generated by amplification from a plasmid template using the Q5 High-Fidelity 2X Master Mix (New England BioLabs) with primers containing truncated Cas9 target sequences (IDT ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA samples were amplified with PCR using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs M0494). Primer pairs for all sequences are listed in Table S3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5ml of the cleaned transposed DNA was used for library amplification (12 cycles) using the NEBNext HiFi 2X PCR Master Mix (New England BioLabs) and previously designed ATAC-seq barcoded primers (Supplemental Table 4 ...
-
bioRxiv - Genomics 2022Quote: ... Transposed DNA fragments were amplified for 13 cycles in the presence of Custom Nextera PCR primers (Buenrostro et al., 2013) using the NEBNext High-Fidelity 2x PCR Master Mix (Cat. #M0541, New England Biolabs). Libraries were purified using the High Pure PCR Production Purification Kit (11732676001 ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... while all other fragments were amplified by PCR using the Q5 HotStart High-Fidelity 2X master mix (New England Biolabs). All plasmids were sequence-verified with Sanger sequencing (Macrogen Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... pre-amplification of cDNA was carried out using Q5High-Fidelity 2X Master Mix (New England Biolabs® Inc., Ipswich, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of the resuspended pooled oligonucleotide library or NNK-based library was used as an initial reverse primer along with 0.5 μM AAV9_K449R_Forward primer in a 25 μL PCR amplification reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). 50 ng of a plasmid containing only AAV9 (K449R ...
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted DNA fragments were then amplified by PCR with Nextera compatible indexed sequencing i5 and i7 adapters using NEBNext 2x PCR Master Mix PCR kit (M0541, NEB). The amplified DNA library was fragment size selected from 200bp to 800bp using Ampure XP beads (A63880 ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Genomics 2022Quote: ... IVT_T7_Forward and reverse primers were added to the product and PCR amplified using LongAmp Taq 2X Master Mix (NEB, M0287S) with the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Tiled 1200 bp amplicons were generated using midnight primers (IDT) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) for 32 cycles (LA-GSU1 to LA-GSU19 ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed on an Applied Biosystems Thermal Cycler using Q5 High-Fidelity 2X Master Mix (New England Biolabs, M0492S). PCR conditions were as follows ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Microbiology 2022Quote: ... double stranded library was amplified using PCR by adding 30 μL of 2X Q5 High Fidelity Master Mix (NEB M0492L), 0.4 μL of 100 μM oDS028 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the DNA fragments were PCR amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs Inc) following manufacturer instructions and the PCR reactions were purified using PureLink™ PCR Purification Kit (Invitrogen).
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... 10µL of transposed DNA was amplified in a 50µL PCR reaction using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541S) for 5 cycles after a 5 min elongation step ...
-
bioRxiv - Molecular Biology 2023Quote: IS element excision from the plasmid backbone was detected by PCR using OneTaq 2X Master Mix with Standard Buffer (NEB) and 0.2 uM primers ...
-
bioRxiv - Synthetic Biology 2023Quote: Sequencing samples were amplified by qPCR for 20 cycles or less and between 600 and 800 relative fluorescence units using Q5 High-Fidelity DNA Polymerase 2X Master Mix (New England Biolabs) to minimize replication errors ...
-
bioRxiv - Cell Biology 2023Quote: ... The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs). The pCAG-EGxxFP plasmid (Addgene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The eluted DNA fragments were then amplified by PCR with Nextera compatible indexed sequencing i5 and i7 adapters using NEBNext 2x PCR Master Mix PCR kit (M0541, NEB). The amplified DNA library was fragment size selected from 200bp to 800bp using Ampure XP beads (A63880 ...
-
bioRxiv - Genetics 2023Quote: ... The primers contained 60 bases pairs of homologies for the downstream and upstream region of the arcZ gene as well as homology with the kanamycin resistance gene (ArcZkanfor and ArcZkan) PCR was carried out with the Q5 2X Master Mix (New England Biolabs). The mixture was run in the thermocycler with a denaturation temperature of 95°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were amplified for 12 PCR cycles with unique dual index primers using the NEBNext Hi-Fi 2X PCR Master Mix (New England Biolabs). Amplified libraries were purified using a 1.2X ratio of Axygen magnetic beads (Corning Inc ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cancer Biology 2023Quote: Full-length KEAP1 WT was amplified out of the pET28a-His6-KEAP1 vector using the Phusion Hot Start Flex 2x Master Mix (NEB) according to the manufacturer’s instructions and appended with EcoRV and NotI restriction sites (for primer sequences ...
-
bioRxiv - Genomics 2023Quote: ... The two primer pools were used to generate tiled amplicons using Q5 high-fidelity 2X master mix (New England Biolabs), followed by a clean up step and quantification using the Qubit ...
-
bioRxiv - Molecular Biology 2023Quote: ... The second strand was synthesized by mixing the following reagents: 25 µL of 2x LongAmp Taq Master Mix (NEB, 174M0287S), 2 µL PR2 primer (ONT cDNA sequencing kit) ...
-
bioRxiv - Genetics 2023Quote: ... via a 20 µL PCR that utilized the following: 10 µL Onetaq Quick-Load 2x master mix (New England Biolabs), 10 µg bovine serum albumin ...
-
bioRxiv - Cell Biology 2023Quote: ... eluted in 20 µl of water and PCR amplified using 25Lμl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541LL), 2.5Lμl of each i5 and i7 Illumina index adapter (IDT ...