Labshake search
Citations for New England Biolabs :
1151 - 1200 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The PaPPase gene was PCR amplified (Q5® Hot Start High-Fidelity 2X Master Mix from NEB, Frankfurt am Main, Germany) with primers introducing a GG-linker along with a 5’ SalI (TTT TTT GTC GAC ATG CAT CAC CAT CAC CAT CAC GGT GGA AAT ATG ATA AGC TAT GCC TTA CTA GG ...
-
bioRxiv - Developmental Biology 2022Quote: ... a SYBR green qPCR side reaction with 1/10 of the preamplified solution to determine the extra cycle number and a final PCR with individually adapted cycle numbers to avoid duplicates and ensure similar final concentrations using NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S) and Nextera Index Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... PCR assays were performed with the strain-specific multiplex primers from (46) and Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions ...
-
bioRxiv - Microbiology 2022Quote: ... pKVS45-tifA ablated ToxN-site was constructed via round-the-horn PCR on pKVS45-tifA using the primer pairs SS-33/34 followed by Gibson Assembly using the 2x HiFi DNA Assembly Master Mix (NEB E2621). TifA codons were recoded using Geneious and ordered as a gene-block fragment from IDT (with 46 of 85 codons recoded with 55 nucleotide changes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR reactions were performed with a final primer concentration of 1 mM using Q5® High-Fidelity 2X Master Mix (NEB). Equal volumes of X and Y PCR reactions were then combined ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs to confirm targeted and untargeted SMN2 loci were performed for each of the cell lines with primer pairs shown in table 1 using High-Fidelity 2X PCR Master Mix (NEB, M0541L) and Thermal Cycler C1000 Touch (Bio-RAD) ...
-
bioRxiv - Neuroscience 2023Quote: Variants were introduced into NaV1.2 by site-directed mutagenesis using Q5 2X high-fidelity DNA polymerase Master Mix (New England Biolabs, Ipswich, MA) as previously described (15) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 µL of the supernatant was used as a template for the PCR reaction using OneTaq® 2X Master Mix with Standard Buffer (New England Biolabs) primers 4925 and 4926.
-
bioRxiv - Genomics 2022Quote: ... 1 μg of gDNA was amplified in a 200 μl reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0491). PCR master mix (100 μl Q5 ...
-
bioRxiv - Microbiology 2023Quote: ... Each sample was amplified in triplicate 25 μl reactions consisting of primers at final concentrations of 0.2 μM and 1X PCR reagent (Q5® Hot Start High-Fidelity 2X Master Mix, New England BioLabs, UK). Triplicate PCR reactions for each sample were then pooled and purified using Agencourt® AMPure® XP beads (#A63881 ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs for screens with the vTR and CoV libraries were performed using NEBNext High-Fidelity 2X PCR Master Mix (NEB #M0541L) with 33 cycles ...
-
bioRxiv - Biophysics 2023Quote: ... PCR was performed according to manufacturer’s instructions for the Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, USA). After 30 s at 98 ℃ for initial denaturation ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and the integrated sgRNA library was amplified from the genomic DNA by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (NEB #M0494L) and oligos ol3 and ol4 (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... 2022) using divergent primers pExTra_F and pExTra_R and assembled with each gene insert by isothermal assembly (NEB HiFi 2X Master Mix).
-
bioRxiv - Genomics 2023Quote: ... Hi-C library was purified by adding 80 μl Ampure beads and amplified in two 100 μl pre-amplification reactions (50 μl 2x NEBNEXT Ultra II Q5 Master Mix (NEB, M0544L), 5 μl 10 μM Nextera-P5-pre-Primer ...
-
bioRxiv - Microbiology 2023Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs). All the plasmids are listed in Table 2.
-
bioRxiv - Biophysics 2023Quote: ... colonies carrying correct clones were identified by colony PCR using OneTaq® Hot Start Quick-Load® 2X Master Mix (NEB), and plasmids were purified from overnight culture in LB containing 150 μg/ml ampicillin at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic DNA was isolated from bulk tumor-bearing lung tissue followed by PCR amplification of the sgID-BC region from 32 μg of bulk lung genomic DNA using Q5 Ultra II High-Fidelity 2x Master Mix (New England Biolabs, M0494X). Unique dual-indexed primers were used to amplify each sample followed by purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Custom Nextera PCR primer and the NEBNext High-Fidelity 2x PCR Master Mix (Nextera DNA Library Preparation Kit (New England BioLabs, E7530L) and purified with the Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: Purified DNA was amplified with human-or mouse-specific primers covering the RBM20 RS-domain mutation hotspot with Nextera-compatible adapters (Sup. Table 1) using Q5®Hot Start High-Fidelity 2X Master Mix (NEB). One microliter of a 1:100 dilution was used for a second PCR attaching sample-specific index barcodes (Nextera XT Index Kit v2 Set A ...
-
bioRxiv - Genomics 2023Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (Fig S4) listed in Table S11 and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted genome DNA was used to amplify the surrounding region of the m.15059G>A mutation for T7 Endonuclease I (T7EI) mismatch detection assay using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, USA) in accordance with recent studies 27 ...
-
bioRxiv - Genomics 2023Quote: ... 21 µl of DNA was mixed with 2 µl of universal i5 and i7 primers (Buenrostro et al. 2015) and 25 µl of NEBNext HiFi 2X PCR master mix (NEB #M0544). Samples were amplified in a thermocycler as follows ...
-
bioRxiv - Microbiology 2023Quote: ... using a minimum of 20 bp overlapping regions between DNA fragments with custom made kit Plasmid selection and verification after the transformation were checked using the OneTaq® 2X Master Mix with Standard Buffer (NEB). Plasmids were purified using the Qiagen plasmid purification kit according to manufacturer’s protocol.
-
bioRxiv - Systems Biology 2023Quote: ... The insert and the destination vector were ligated in a 10 µl reaction with 2X instant sticky-end ligase master mix (NEB #M0370S), using a 1:5 molar ratio of backbone-to-insert and otherwise following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was then used for PCR with the OneTaq 2x Master mix with Standard Buffer (New England Biolabs, Ipswich, Massachusetts). Targets for differential editing of the mutant in p150 and p110 were ...
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Molecular Biology 2023Quote: ... ATAC-seq libraries were then prepared using Custom Nextera PCR primers and NEBNext High-Fidelity 2x PCR Master Mix (NEB, #M0541).
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 μL of this was then used to template an 8 μL PCR using LongAmp® Hot Start Taq 2X Master Mix (M0533, NEB) with each amplification containing a unique combination of forward and reverse sequencing-barcoded primers that were cherry-picked into PCR reactions using Echo 525 with a 384PP plate as was done in the construction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear DNA constructs encoding Dam or eGFP were amplified via PCR from the plasmids pJV302 (Dam) and pJV170 (eGFP) using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S). PCR reactions were treated with 1 μL of DPNI for 3 h at 37°C and purified with Zymo Research’s Clean & Concentrator-5 kit according to the manufacturer’s protocol (Zymo CN# D4004).
-
bioRxiv - Immunology 2024Quote: ... the post-capture PCR of the sample-bead conjugate was performed with 25 μL LongAmp Taq 2x Hot Start Master Mix (New England Biolabs, M0533), 1 μL 10 μM forward (10x_cDNA_fwd ...
-
bioRxiv - Genetics 2023Quote: ... we split clean genomic DNA into PCR replicates (each containing gDNA from approximately 250,000-500,000 cells) and amplified the genomic region of interest with Q5 High-Fidelity 2X Master Mix (New England Biolabs, no M0492L) and 0.5 uM of each amplification primer (Supplementary Table 11) ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR reaction was carried out in the volume of 50 µL including 25 µL 2X OneTaq Master Mix (NEB, #M0482), 2 µL of 5 µM i5 and i7 each ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro transcription templates were prepared via 8 cycles of PCR using 2x Q5 Master Mix (New England Biolabs, Cat. M0492S) with a T7 promoter containing forward primer as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two microliters of digested samples were used to run the reaction of PCR with Taq 2X Master Mix (New England Biolabs (UK) Ltd ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using LUNA SYBR (NEB) on a Rotorgene (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 2.5 µL aliquot of the samples was taken for qPCR to check the number of cycles using the NEB Luna 2x mix (New England Biolabs, Ipswich, MA). After completing the required number of additional PCR cycles ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Invitrogen Platinum™ SuperFi™ Green PCR Master Mix or Q5® High Fidelity Polymerase (New England Biolabs) were used for generation of backbones from p005 and p006 vectors (appendices ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real time PCR (qRT-PCR) was performed with the Luna Universal qPCR Master Mix (New England Biolabs #M3003) on a CFX Connect instrument (BioRad #1855200) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real time PCR (qRT-PCR) was performed with the Luna Universal qPCR Master Mix (New England Biolabs #M3003) on a CFX Connect instrument (BioRad #1855200) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR (qRT-PCR) was performed in duplicate with the Luna® Universal qPCR Master Mix (NEB, M3003) using QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed with a oligonucleotide concentration of 300 nM using the Luna Universal qPCR Master Mix (NEB). The results were analyzed using the Applied Biosystems 7500 Fast Real-Time PCR Software v2.3 (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... The overall abundance of P0 gRNA genes was quantified with Luna® Universal qPCR Master Mix (NEB, Cat: M3003S) using primer pair F/R’ (Fig ...