Labshake search
Citations for New England Biolabs :
1201 - 1250 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and real-time PCR was performed using the Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) on an ABI 7500 Fast RT-PCR system (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... The synthesized cDNAs were then used for quantitative PCR by using Luna Universal qPCR Master Mix (New England Biolabs). The following PCR Primers were used in this study ...
-
bioRxiv - Bioengineering 2023Quote: ... qPCR was performed using 67.5ng of gDNA for each condition in 10µl reactions using Luna Universal qPCR Master Mix (NEB, M3003E).
-
bioRxiv - Plant Biology 2022Quote: ... were analyzed by Quantitative real time PCR (qRT PCR) using Luna® Universal qPCR Master Mix (New England BioLabs) in a QuantStudio® 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Ten-fold diluted cDNA was used in qRT-PCR using Luna Universal qPCR Master Mix (New England Biolabs #M3003E) in a final 10 µL reaction in QuantStudio 3 Real-Time PCR machine (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... libraries were quantified in triplicate using NEB Luna® Universal Probe qPCR Master Mix (New England Biolabs, Ipswitch, MA), Illumina PhiX standard (San Diego ...
-
bioRxiv - Molecular Biology 2021Quote: ... repaired and end-prepped DNA was barcoded with Native Barcode by NEB Blunt/TA Ligase Master Mix (NEB), followed by purification with DNA Clean Beads ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... using Gibson assembly master mix (NEB)79 ...
-
bioRxiv - Microbiology 2019Quote: ... using NEBuilder HiFi Master Mix (NEB). FliF was expressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... Luna qRT-PCR Master Mix (NEB) was used with the primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Gibson Assembly® Master Mix (NEB), Ampicillin (BRAND) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the M1800 LAMP Master Mix (NEB), water ...
-
bioRxiv - Neuroscience 2020Quote: ... Luna qRT-PCR Master Mix (NEB) was used with the primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... High-fidelity PCR Master Mix (BioLabs) and a touch-down annealing process were used for amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with NEBuilder HiFi Master Mix (NEB). The resulting plasmid lentiMPRA library was electroporated into 10-beta competent cells (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and OneTaq PCR Master Mix (NEB). Reverse primers for most sgRNAs also contained a unique KpnI or BglII site to assist clone identification by restriction fragment analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.32× Ligation master mix (E7595, NEB), 0.011× Ligation enhancer ...
-
bioRxiv - Microbiology 2022Quote: ... assembled with Gibson Master Mix (NEB), and finally transformed into chemically competent DH5α E ...
-
bioRxiv - Systems Biology 2022Quote: ... and PCR master mix (NEB, M0543S). We used 12 cycles to amplify the cDNA using the following protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gibson Assembly® Master Mix (NEB), Ampicillin (BRAND) ...
-
bioRxiv - Genomics 2022Quote: ... using Gibson Assembly Master Mix (NEB). Positive FB constructs were analysed by Sanger sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... and PCR Master Mix (NEB, M0543S) for each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... Gibson Assembly® Master Mix (NEB), ampicillin (BRAND) ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Gibson assembly master mix (NEB) (Gibson et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... and PCR master mix (NEB, M0543S). The amplification began with a 30-second denature step at 98°C ...
-
bioRxiv - Plant Biology 2023Quote: ... using HiFi assembly master mix (NEB), followed by recombination into pMpGWB301 or pMpGWB308m (modified version of pMpGWB308 (Ishizaki et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Gibson Assembly® Master Mix (NEB), and NEB® 5-alpha Competent E ...
-
bioRxiv - Molecular Biology 2024Quote: ... with NEBNext Q5U Master Mix (NEB) using the following thermocycling protocol ...
-
bioRxiv - Genetics 2021Quote: Transposase reactions were initially amplified by 8 cycles of PCR using primers described by Buenrostro et al (2013) and 2X NEBNext Q5 HotStart HiFi Master Mix (New England Biolabs, Cat# M0543). Amplicons of 175 -250bp were size-selected using agarose gel electrophoresis on BluePippin 2% gel cassettes (Sage Science ...
-
bioRxiv - Developmental Biology 2020Quote: ... eluted in 20 μl of water and PCR amplified using 25 μl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541 L), 2.5 μl of P5_BRB primer (5 μM ...
-
bioRxiv - Immunology 2021Quote: ... 45 μl of cDNA from the synthesis reaction was mixed with primers and Q5® High-Fidelity 2X Master Mix(NEB, USA). The PCR program began with an initial denaturation at 95°C for 1.5minutes ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Unique barcoded adaptor sequences were ligated to each sample of tagmented gDNA with 14 cycles of PCR using OneTaq 2x Master Mix (NEB, cat# M0482S), and all samples were pooled into a single multiplexed sequencing library ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Single primer PCR was performed in 2 different tubes for each plasmid using Q5 2X Master Mix (New England Biolabs Cat.No M0492S). After the amplification ...
-
bioRxiv - Developmental Biology 2021Quote: ... The template for probe synthesis was generated through two rounds of standard PCR method using OneTaq® 2x Master Mix (New England Biolabs, NEB): the first PCRs from cDNA used the gene-specific primers including the T7 linker sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Triplicate NEBuilder HiFi assembly reactions were prepared according to manufacturer’s protocols containing ∼2:1 insert to vector as follows: 10 µl of 2X NEBuilder HiFi master mix (New England Biolabs, cat#E2621S), 158.7 ng of DNA fragments ...
-
bioRxiv - Neuroscience 2021Quote: ... 15 ng of template DNA extracted from fecal samples were added to the LongAmp Hot Start Taq 2X Master Mix (New England Biolabs, Ipswich, MA). Initial denaturation at 95 °C was followed by 35 cycles of 20 s at 95 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... encoding a 7-mer insertion between amino acid residues 588 and 589 of AAV9 was used as the reverse primer along with the Assembly-Xbal-F oligo (CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid.
-
bioRxiv - Microbiology 2019Quote: ... A high fidelity PCR was performed with the same 16S primers but using Q5 Hot start 2x master mix (New England Biolabs, Hitchin, U.K.). After amplification ...
-
bioRxiv - Microbiology 2019Quote: ... each of the amplicons were diluted to 0.5 nM and amplified using barcoding primers (1D PCR Barcoding Amplicon Kit, Oxford Nanopore Technologies, [ONT], UK) and LongAmp Taq 2X Master Mix (New England Biolabs, MA, USA) with the following conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA substrates used for digestion reactions were either generated by PCR using Q5® High-Fidelity 2X Hot Start Master Mix (NEB #M0494), oligonucleotides produced by IDT ...
-
bioRxiv - Genetics 2020Quote: ... This exonuclease-treated Klenow amplification was then used as a template in a standard 15-cycle PCR (Taq 2X Master Mix; New England Biolabs, MA. USA) using Illumina IDT-NXT primers carrying dual indexes (Supplemental Data 4).
-
bioRxiv - Synthetic Biology 2019Quote: ... individual oligo libraries were PCR-amplified using 15 nt amplification primers with Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA), and number of cycles determined by qPCR ...
-
bioRxiv - Genomics 2021Quote: ... thirty-two 50 µl PCR reactions were performed using 500 ng genomic DNA for each reaction and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, M0541S). The purified libraries were sequenced on the NovaSeq 6000 with 150-bp paired-end sequencing ...
-
bioRxiv - Genetics 2020Quote: ... All the PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (Catalog number: M0541L, New England Biolabs Inc., USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... was isolated from cDNA of devil peripheral blood mononuclear cells (PBMCs) by PCR using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic loci were then amplified using primers targeting genes of interest (see Table S9 for a list of primers) using Q5 Hot Start High-fidelity 2X Master Mix (NEB, Cat. #M0494). One exception was the CHD sextyping amplification protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... initial PCR amplification of sgRNA cassettes adding overhang adapter sequence was performed using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494S). For each sample ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... Each PCR (performed in triplicate for each sample) was done in a 25 μl volume using Q5 High-Fidelity 2X Master Mix (NEB, cat# M0492L), 5 pmol of each primer and 50 ng template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... and used as “megaprimers” that are denatured and annealed to the original plasmid (pNG93) to amplify the vector backbone using Q5® High-Fidelity 2X Master Mix (NEB, M0492S). The reactions were then digested with DpnI to eliminate any remaining parental plasmid DNA ...