Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4746 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Microbiology 2023Quote: ... and used as “megaprimers” that are denatured and annealed to the original plasmid (pNG93) to amplify the vector backbone using Q5® High-Fidelity 2X Master Mix (NEB, M0492S). The reactions were then digested with DpnI to eliminate any remaining parental plasmid DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The backbone of the library was amplified from pTL002 with homology tails by Q5 Hot Start High-Fidelity 2X Master Mix (NEB CN# M0494S). 125-nt ssDNA with 9 random nucleotides at the RBS and the first base of the start codon region was synthesized by Eurofins ...
-
bioRxiv - Evolutionary Biology 2023Quote: We designed amplification primers for the extracted assembly sequences using Geneious Prime (Biomatters Ltd) and generated PCR amplicons using Q5 High-Fidelity 2X Master Mix (New England Biolabs catalog # M0492), Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs catalog # M0531) ...
-
bioRxiv - Cell Biology 2023Quote: Mutagenesis and all DNA modifications were carried out using Q5 Hot Start high- fidelity 2X Master Mix (New England BioLabs, Cat# M0494L) using the recommendations of the manufacturer ...
-
bioRxiv - Systems Biology 2023Quote: ... a barcode fragment was generated by PCR-amplifying a 326 bp amplicon from the pDL00210 template and using the Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA) and primers oDL00747 and oDL00748 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA synthesis across the methylated linearized pBlueScript template was subsequently performed in Q5® High-Fidelity 2X Master Mix (New England Biolabs, Inc.) using a 5’ biotinylated primer (5’-/5Biosg/CGTTCTTCGGGGCGAAAACTCTCAAGG −3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... appropriate number of amplification cycles x (98C - 10sec, 63C – 30sec, 72C – 1 min) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Neuroscience 2023Quote: ... Up to 10 ng of gDNA was amplified in a 20 μl volume using NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) supplemented with 5% dimethyl sulfoxide and barcoded primers specific to HTT Exon 1 (0.5 μM each) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All polymerase chain reactions (PCR) used for routine cloning were conducted using Q5 High Fidelity DNA polymerase 2X Master Mix (New England BioLabs, Ipswich, MA). Plasmids were constructed using isothermal DNA assembly with 40-60 bp overhangs (NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... Up to 10 ng of gDNA was amplified in a 20 μl volume using NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) supplemented with 5% dimethyl sulfoxide and barcoded primers specific to HTT Exon 1 (0.5 μM each ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR cycles were carried out with Illumina Nextera adapter primers using the NEBNext High Fidelity 2x Master Mix (NEB, Cat# M0541S) using the following PCR program ...
-
bioRxiv - Genomics 2020Quote: ... PCR mix (NEBNext Ultra II Q5 Master mix, NEB M0544), USER enzyme (NEB M5505) ...
-
bioRxiv - Microbiology 2023Quote: ... Specific forward primer targeting E1 and a reverse primer targeting the nongenomic tag were used in 20 ul SYBR Green reaction with 1x Luna qPCR Dye (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Each PCR mix contained of 25µl of NEB 2x PCR Mix (New England Biolabs), 2.5µl of 25µM forward primer (Primer Ad1_noMX) ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using OneTaq 2ξ Master Mix or Q5 High-Fidelity 2ξ Master Mix from NEB according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed on cDNA from samples for genes of interest using the Luna Universal qPCR Master Mix (#M3003, New England Biolabs) according to manufacturer’s specifications ...
-
bioRxiv - Genetics 2021Quote: ... One-tenth of the RT reaction was used as a template for real-time PCR using Luna Universal qPCR Master Mix (New England Biolabs) on a QuantStudi 6 system ...
-
bioRxiv - Microbiology 2019Quote: ... in 20 µL reaction volume including: 10 µL Luna Universal qPCR Master Mix (New England Biolabs, Inc., Cat. No. NC1276266), primers listed in Table 2 ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR reaction volumes were set up to 12.5 μL containing Luna Universal qPCR Master Mix (New England Biolabs Inc.), 2 μl of a 1:10 dilution of cDNA reaction ...
-
bioRxiv - Microbiology 2021Quote: ... and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT, Reverse Primer: AACACACCGRTTCTCGTCCTC) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... are decided by the Ct value from a qPCR reaction (NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) for the specified cDNA concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... multiplex qPCR was performed on a Bio-Rad C1000 Touch Thermal Cycler using Hot Start Taq 2× Master Mix (NEB) with HT_Forward and HT_Reverse primers (IDT ...
-
bioRxiv - Bioengineering 2023Quote: ... are decided by the Ct value from a qPCR reaction (NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) for the specified cDNA concentration ...
-
bioRxiv - Microbiology 2023Quote: ... and FAM-labeled TaqMan probe were used in viral negative strand quantification with Luna Universal Probe qPCR Master Mix (New England Biolabs). The reactions were run under the cycling conditions as follows ...
-
bioRxiv - Microbiology 2023Quote: ... at a final volume of 20 μL with 10 μL of Luna Universal qPCR Master Mix (New England Biolabs, Germany), which uses SYBR Green chemistry ...
-
bioRxiv - Cancer Biology 2022Quote: ... reactions were performed in 96-well plates using 5ng of cDNA samples using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCRs were performed with GoTaq® qPCR mix (NEB, Cat. No. A6001) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... the variable regions V5-V7 of the bacterial 16S rRNA gene were amplified by PCR (NEBnext High Fidelity 2x Master Mix, New England Biolabs, Ipswich, MA, USA) using 10 ng of DNA per reaction and the primers 799F and 1193R from (Bulgarelli et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each of the tubes were filled to 30 µL using 15 µL Q5 Hot Start High-Fidelity 2X Master Mix (NEB, #M0493S, Ispwich, MA), 1.5 µL of 20X Evagreen (Biotium ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reaction mix was set up in duplicate for each sample with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) with annealing conditions of 54°C for 25 cycles ...
-
bioRxiv - Genetics 2022Quote: ... The gRNA binding regions were checked for presence of single nucleotide polymorphism (SNP) by amplifying the region using One Taq 2X master mix (New England Biolabs, Ipswich, Massachusetts, USA) and subsequent sanger sequencing of the PCR product (primers designed by primer-BLAST ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 1524 bp cDNA fragment (encoding 508aa) was PCR amplified from bovine superficial zone articular chondrocyte cDNA using the Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0492S) and then cloned into the pCR®-Blunt vector (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out in a final volume of 50 μL with 25 μL Taq 2X Master Mix (New England BioLabs, Ipswich, MA USA), 1 μL each forward and reverse primers (10 μM ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Q5® High-Fidelity 2X Master Mix was used for long PCRs (Product M0492SNew England Biolabs 240 County Road Ipswich, MA 01938-2732). The correct gene products were confirmed by DNA sequencing (BaseClear BV ...
-
bioRxiv - Cancer Biology 2019Quote: ... the hCD19t and mCD19t cDNAs were PCR-amplified from the plasmids hCD19t-2A-IL2-pHIV7 and mCD19t-epHIV7 using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers ...
-
bioRxiv - Physiology 2020Quote: ... and the coding regions of the two isoforms were amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, MA, USA) using isoform-specific primers (Supplemental Table 1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... we amplified PCR fragments with the respective primers containing the gRNA sequences (Table S1) and utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). After gel-purification of the PCR fragments with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... was amplified from yw DNA with the primers KpnI-twiVLM-fw (GGGGT ACCCCCAGTAAGGCAAATTGCTCAG) and XhoI-twiVLM-rev (CCGCTCGAGCGGAACTTGC CTTGTCCTTCGTC) utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. No: M0494L). The resulting PCR product was gel purified with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: Duplicate PCR reactions were set up for each sample with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) in a 15 μL reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... a near full-length pulA gene fragment was amplified with Phusion Hot Start Flex 2X Master Mix (New England Biolabs, Ipswich, MA, USA) using the following primers ...
-
bioRxiv - Systems Biology 2022Quote: ... and the coding region of the gene was amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, MA, USA) using Nha1-specific primers (Supplemental Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... The regions upstream and downstream of the operon were then amplified using Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, Massachusetts, USA) with the following primers that contain overlapping regions with the plasmid pG+host9 (Maguin et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Colony PCRs for crRNA integrations into pCRISPR-Cas3 were performed using OneTaq® 2X Master Mix with Standard Buffer Enhancer (New England BioLabs Inc., U.S.A).
-
bioRxiv - Microbiology 2023Quote: ... PCR was conducted using a Rapid Barcoding Kit 96 (ONT, Oxford, UK) with Q5® Hot Start High-Fidelity 2X Master Mix (NEB, Ipswich, MA) according to the manufacturer’s protocol designed for SARS-CoV-2.
-
bioRxiv - Microbiology 2023Quote: ... Amplification was achieved through 16S rRNA gene Polymerase Chain Reaction (PCR) with Illumina (San Diego, USA) adapted primers [50] and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, USA) at 98°C (2 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA fragments were either amplified from available plasmids or synthesized gBlocks™ (Integrated DNA Technologies) using Q5 Hotstart Start High-Fidelity 2X Master Mix (New England Biolabs, Cat. #M0494S). The generated plasmids were transformed into Zymo JM109 chemically competent E ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments for plasmid construction were amplified using Q5 DNA polymerase and colony PCRs were performed with OneTaq 2X Master Mix (New England BioLabs, Ipswich, Massachusetts, USA).
-
bioRxiv - Plant Biology 2024Quote: ... Both the synthesized genes and PCR amplified genes were then inserted into a doubly digested BamHI/XhoI pET28b(+) through Gibson assembly using the 2X Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The following PCR primers were used to amplify cut sites with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA): IRF4 5’ - AGGTGCCTTCTTCCGGGG – 3’ & 5’ - TTGCGTGGAAACGAGAACGC – 3’ ...