Labshake search
Citations for New England Biolabs :
9101 - 9150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The purified product was subjected to EcoRI-HF (NEB #R3101S) and XbaI (NEB #R0145 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The amplified fragment was digested by DpnI (NEB #R0176) for an hour at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.6 µL of Phusion High-fidelity DNA Polymerase (NEB M0530), 8 µL of 5x Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and XbaI (NEB #R0145) at 37°C overnight and size-selected using FastGene PCR/Gel Extraction Kit (Nippon Genetics #FG-91302) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The amplified barcode-EGFP fragment was pooled into a single tube (1,000 µL in total) and digested with 12.5 µL of DpnI (NEB #R0176) at 37°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... performed double digestion using EcoRI-HF (NEB #R3101S) and BamHI-HF (NEB #R3136S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and PvuI-HF (NEB #R3150S), and confirmed that all the tested clones (16/16 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and BamHI-HF (NEB #R3136S), and Sanger sequencing using sequencing primers SI#514 and RS#147 for uptag and dntag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 25 µg of pRS193 lentiviral cloning backbone plasmid was digested by EcoRI-HF (NEB #R3101S) and XbaI (NEB #R0145 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and XbaI (NEB #R0145S) digestion overnight at 37°C and purified again by FastGene PCR/Gel Extraction Kit (Nippon Genetics #FG-91302) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and XbaI (NEB #R0145) digestion overnight at 37°C and purified again by FastGene PCR/Gel Extraction Kit (Nippon Genetics #FG-91302) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 25 µL of 10x T4 DNA Ligase Buffer (NEB #B0202) were mixed in a total volume of 250 µL and incubated overnight at 16°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 3.2 µL of 2.5 mM dNTPs (NEB #N0447 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli cells (NEB # C3040I). The transformation was performed in a total of 17 reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.2 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530), 4 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Systems Biology 2023Quote: ... while a E.Coli 70s ribosome (NEB, cat nr P0763S) was used to estimate which fractions to use for ribosome XL-MS.
-
bioRxiv - Systems Biology 2023Quote: Each target was PCR-amplified from the genomic DNA of the strain listed on the top hits file then inserted into the backbone of plasmid pBb(RK2)1k-GFPuv using either restriction digest cloning or NEBuilder® HiFi DNA Assembly (New England Biolabs; Ipswich, MA) using the primers listed in Table S4 ...
-
bioRxiv - Systems Biology 2023Quote: ... adaptors were ligated using NEBNext Multiplex Oligos index (NEB). Phage lambda DNA was added to fill the low input to 100 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... Cloning of synthetic DNA constructs was conducted using chemically competent DH10-β cells purchased from NEB (New England Biolabs, Ipswitch, MA) or XL-1 Blue (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... for 5 h in 4ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... and re-ligated using T4 DNA Ligase (NEB) to generate the deletion ...
-
bioRxiv - Plant Biology 2023Quote: ... The digested plasmid was then blunted using Quick Blunting kit (NEB) and re-ligated using T4 DNA Ligase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... and re-ligating using T4 DNA Ligase (NEB).
-
bioRxiv - Plant Biology 2023Quote: ... Six variants were mutated on the basis of proPIF4-L:LUC using Q5 site-directed mutagenesis kit (NEB, E0552S) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: IFRD1 splicing variants were amplified using Q5 High Fidelity Polymerase (New England Biolabs, Ipswich, MA, USA, Cat. # M0491S) on an AriaMX Real-Time PCR System (Agilent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... “single-cell transcriptomes attached to microparticles” (STAMPs) were washed and proceeded to the Exonuclease I (NEB #M0293L) treatment ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of 5x Phusion HF Buffer (NEB #B0518S), and 2 µL of 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.2 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530), 4.5 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.4 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530S), 8 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.4 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530L), 8 µL of 5x Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530S), 8 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6.4 µL of Phusion HF Buffer (NEB #B0518S), and 0.64 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The purified barcode fragment was then assembled into the cloning backbone plasmid pKI110 by Golden Gate Assembly (66) using BsmBI (NEB #R0580S). We performed two assembly reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the plasmids for the Blasticidin and Zeocin resistance marker-based systems were introduced to T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.2 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530L), 4 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.2 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530), 4.5 µL of 5x Phusion HF Buffer (NEB #B0518) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.4 µL of Phusion High-fidelity DNA Polymerase (NEB #M0530L), 4 µL of 5x Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 500 µL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4.5 µL of Phusion HF Buffer (NEB #B0518S), 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.4 µL of Phusion High-Fidelity DNA Polymerase (NEB #M0530L), 8 µL of Phusion HF Buffer (NEB #B0518S) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518), and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 1.6 µL of 2.5 mM dNTPs (NEB #N0447), with the following thermal cycler condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1.6 µL of 2.5 mM dNTPs (NEB #N0447), with the following thermal cycle condition ...