Labshake search
Citations for New England Biolabs :
9151 - 9200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the desired products were agarose gel purified using a Monarch gel extraction kit (NEB) and sequenced on an Illumina HiSeq.
-
bioRxiv - Molecular Biology 2023Quote: Luna Universal qPCR Master Mix (New England Biolabs, USA) and other reaction components were thawed at room temperature and gently vortexed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM MgCl2, 1% CHAPS,2.5 mM DTT, 50 µg/mL cycloheximide, 20 U RNase inhibitor murine, New England BioLabs, EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2023Quote: ... and barcodes and full Illumina adapters were added through PCR using Phusion (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... coli poly(A) polymerase (NEB) and reverse transcribed with SuperScript III (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... After blunting the SacI site by the Quick Blunting Kit (NEB), the digested plasmid was self-ligated.
-
bioRxiv - Microbiology 2023Quote: ... The product was restricted with Dpn1 (NEB, R0176S) to remove the template DNA and purified with a Monarch PCR and DNA cleanup kit before transforming.
-
bioRxiv - Microbiology 2023Quote: ... The product was purified with a Monarch PCR and DNA cleanup kit (NEB, T1030) and restricted with enzymes Nde1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and restricted with enzymes Nde1 (NEB, R0111) and Kpn1-HF (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and HindIII-HF (NEB, R3104) before ligating.
-
bioRxiv - Microbiology 2023Quote: ... The product was restricted with enzymes BamH1-HF (NEB, R3136) and HindIII-HF (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and Kpn1-HF (NEB, R3142) using NEBcloner® protocols to prepare for ligation into the pCW-lic backbone ...
-
bioRxiv - Microbiology 2023Quote: Each LAMP-OSD reaction totaled 25 μl using (New England Biolabs, Ipswitch ...
-
bioRxiv - Microbiology 2023Quote: A PCR amplification using Phusion® High Fidelity DNA Polymerase (NEB, M0530S) was performed on pCW-gna-bilRS with forward primer GAAGTACACGGAGGGGGGCTGATCGGATCATTCTGTTCG and reverse primer GAATGATCCGATCAGCCCCCCTCCGTGTACTTCTATAATATC to amplify the pCW-gna-bilRS plasmid and introduce a mutation of the 166 aspartic acid and 167 arginine to glycines ...
-
bioRxiv - Microbiology 2023Quote: ... The restricted insert and dephosphorylated backbone were ligated with T4 DNA ligase (NEB, M0202) to form the construct.
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Microbiology 2023Quote: ... and pN1-370 were generated using Q5 Site-Directed Mutagenesis Kit (NEB). Primers are shown in Supplementary Table 1.
-
bioRxiv - Molecular Biology 2023Quote: A similar strategy was used to capture VirB-mediated changes in supercoiling using T4 DNA ligase with the following exceptions: i) purified PicsP-lacZ was nicked once using Nb.BsrD1 (NEB # R0648S) for 1 h at 65 °C and then purified using phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... pDS01 and pDS02 were constructed by restriction digestion with BamHI and SbfI followed by ligation with a Quick Ligation Kit (NEB). All other plasmids were constructed using a HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... and ligated into XbaI-digested pMH94 using T4 DNA ligase (New England Biolabs) at 16°C O/N ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction mixture contained: 12.5 µL LUNA LongAmp Taq 2x Master Mix (NEB M0287S), 5.5 µL Nuclease-Free Water (ThermoFisher Scientific #AM9937) ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were pooled into a library using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) and subsequently sequenced on Illumina NextSeq500 platform (75 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... Adaptor ligated cDNA was PCR enriched to incorporate an Illumina compatible index sequence (NEBNext Multiplex Oligos for Illumina, Dual Index Primers Set1, E7600S, New England Biolabs). The libraries were purified using AmPure XP beads ...
-
bioRxiv - Neuroscience 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760S, New England Biolabs) was used to prepare the sequencing libraries ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was isolated and fragmented using the NEBNext poly(A) mRNA magnetic isolation module (E7490S, New England Biolabs). First and second strands of cDNA were synthesized and purified using AmPure XP beads (A63880 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 7f variants were derived by site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis Kit) of the GCaMP6s sequence in pDSP23 to reproduce the mutations described for GCaMP6f (pDSP31 ...
-
bioRxiv - Neuroscience 2023Quote: ... These two gene fragments were used directly for DNA assembly (New England Biolabs) into pDSP9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Construction of the PRP18/pUG35 and PRP18/YEp24 base plasmids was accomplished using Gibson assembly43 (New England Biolabs #E2611). Unless otherwise indicated in the figure legends ...
-
bioRxiv - Microbiology 2023Quote: ... in NEBuffer 2 (NEB) for 2 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were treated with Shrimp Alkaline Phosphatase (SAP; from NEB). In short ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were treated with 4 U DNase I (NEB) for 30 min at 37°C and subsequently separated on urea-polyacrylamide (PAA ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide 5S-rRNA-oligo was labelled using T4 PNK (NEB) and [γ-32-P]-ATP (Hartmann Analytics ...
-
bioRxiv - Microbiology 2023Quote: ... A RNA cleanup kit (Monarch RNA Cleanup Kit T2050, New England Biolabs, France) was used to further clean the RNA samples ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... and PacBio sequencing were prepared using the NEB Monarch HMW DNA Extraction Kit for Cells and Blood (NEB #T3050) using the manufacturer’s protocol for fresh blood with slight modifications as we have previously described (28) ...
-
bioRxiv - Microbiology 2023Quote: ... pJSB161 vector (Blevins et al., 2007) using the NEBuilder HiFi DNA assembly master mix according to the manufacturer’s instructions (NEB).
-
bioRxiv - Microbiology 2023Quote: ... according to the manufacturer’s instructions (NEB). The potB translational luciferase reporter fusion plasmid was constructed by PCR-amplifying (primers PA400 + PA402 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... in 1X T4 RNA Ligase Buffer (NEB), 9% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... the Q5 site-directed mutagenesis kit (New England BioLabs) was applied ...
-
bioRxiv - Microbiology 2023Quote: The C2566 (New England Biolabs) cell strain was used for all protein expression and co-expression assays ...
-
bioRxiv - Microbiology 2023Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) was used ...
-
bioRxiv - Microbiology 2023Quote: ... Phosphorylated primers containing one half of the barcode each at the 5’ ends were used to linearize the pUC-BC plasmid and the resulting amplicon was ligated using T4 DNA Ligase (NEB M2200L). The purified ligation reaction was transformed into NEB-10-Beta competent cells (NEB C3020K ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using OneTaq 2ξ Master Mix or Q5 High-Fidelity 2ξ Master Mix from NEB according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... ligation with T4 DNA ligase (New England Biolabs) and transformation in commercially available TOP10 competent E ...
-
bioRxiv - Microbiology 2023Quote: ... The proteases used in this experiment include the prototypical proprotein convertase furin (New England BioLabs) and the prototype serine endopeptidase trypsin (New England BioLabs) ...