Labshake search
Citations for New England Biolabs :
9351 - 9400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... purified RNA was incubated with mRNA decapping enzyme and buffer (NEB) for 1hr at 37℃ ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA was sheared by the addition of a range of DNase I (NEB) concentrations (0.5 – 2U) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1X T4 RNA Ligase Buffer (New England Biolabs), 0.5 U/μl SuperaseIN (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μl of a master mix that contained 1X DNA Adenylation Buffer (New England Biolabs), 100 μM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μM Mth RNA Ligase (New England Biolabs) was split into two 50 μl aliquots in thin-walled PCR tubes and incubated at 65°C in a thermal cycler with a heated lid set to 105°C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: 9N_VRA3 adapter oligonucleotide (Supplementary Table 1) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) according to the manufacturer’s protocol at a 5X scale ...
-
bioRxiv - Molecular Biology 2023Quote: ... KQ (New England Biolabs). The samples were mixed by pipetting and incubated at 25°C for 2 hours.
-
bioRxiv - Molecular Biology 2023Quote: ... and pACG9-[EC1-10]) were generated through site-directed mutagenesis (NEB Q5 site-directed mutagenesis kit; New England Biolabs, Ipswich, MA, USA). Specifically ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers CR66 and CR67 and inserted it into pMT-Hrp48-Linker-APOBEC-P2A-dsRed (pCR8) digested with KpnI and NotI to remove Hrp48 using NEBuilder (NEB). To clone pMT-Thor-ADAR-P2A-dsRed (pCR30 ...
-
bioRxiv - Molecular Biology 2023Quote: ... This fragment was ligated into PmeI and Not1-digested pMT-Hrp48-ADAR-E488Q using T4 ligase (NEB). pMT-Hrp48-APOBEC-P2A-dsRed (pCR8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and re-circularized the plasmid using T4 blunt-end ligation (NEB). To clone pMT-Thor-APOBEC-P2A-dsRed (pCR26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBuilder (NEB) unless otherwise noted ...
-
bioRxiv - Molecular Biology 2023Quote: ... We inserted all fragments into vectors using either Gibson Assembly (NEB) or NEBuilder (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was done using the Q5® Site-Directed Mutagenesis Kit from New England Biolabs (NEB; Ipswich, MA, USA), following their protocol with recommended annealing temperature and pETσ70 CFI ...
-
bioRxiv - Molecular Biology 2023Quote: Core RNAP was purchased from NEB (Ipswich, MA, USA). WT σ70 and the σ70 D445V variant were purified as previously described [131 and 132 ...
-
bioRxiv - Molecular Biology 2023Quote: 75ng of the amplified library was used as input for an RNA Synthesis Kit (NEB, E2050S) and concentrated using a Monarch RNA clean-up kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... it is possible to use the Taq DNA ligase (NEB) with ~20 cycles of denaturation at 95 °C for 1 min followed by annealing and ligation steps using proper Tm for 1 min (Tm of 68 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 units Exonuclease I enzyme (NEB) is added to ligation mixture for non-circular ssPCRP degradation.
-
bioRxiv - Molecular Biology 2023Quote: ... 0.52 and 0 nM) in a final volume of 30 μL of amplification mixture including: 1X Phi29 DNA polymerase buffer (NEB), 0.3 μM non-modified PCR forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ligation reaction was performed by introducing 10 units T4 DNA ligase enzyme (NEB, USA) and incubating at 20 °C for 1 hour to seal the 5’ and 3’ ends of the ssPCRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg bovine serum albumin (BSA) and 8 units Phi29 DNA polymerase enzyme (NEB). Amplification reactions were monitored for 5 hours at 30 °C in MicroAmp fast reaction tubes with cap (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... were manipulated in a final volume of 20 μL labeling mixture containing 1X T4 polynucleotide kinase (PNK) enzyme buffer (NEB), milli-Q water ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted with Monarch® HMW DNA Extraction Kit for Cells & Blood (NEB), digested with DpnI overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library preparation was done using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEW ENGLAND BioLabs) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... The transcription of guide RNAs (gRNAs) was performed with HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... 400ng of total RNA was used for reverse transcription using LunaScript™ RT SuperMix Kit (NEB, USA). qPCR was performed using Forget-Me-Not™ EvaGreen® qPCR Master Mix (Biotium ...
-
bioRxiv - Neuroscience 2023Quote: ... Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs) using manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... double strand DNA template oligos were synthesized using a Phusion High-Fidelity DNA Polymerase (New England BioLabs) with the T7 specific forward primer 5’-GAAATTAATACGACTCACTATAGGN18GTTTTAGAGCTAGAAATAGC-3’ together with the common reverse primer 5’- AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC-3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... NFAT1 (New England BioLabs), BDNF (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... β-catenin (New England BioLabs), TCF/LEF family antibody sampler kit (New England BioLabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were treated with DNase I (10 U/mL, New England Biolabs, M0303S) for 1 h at 37 °C and rinsed in PBS (three times ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...
-
bioRxiv - Microbiology 2023Quote: ... A pOUPc plasmid (e.g., pOUPc-UL148HA, ref: [94] was linearized by double-digested with MluI-HF (NEB Cat#: R3198L) and AgeI-HF (NEB Cat# ...
-
bioRxiv - Microbiology 2023Quote: ... in 1x CutSmart buffer (NEB Cat#: B7204S) to release the insert ...
-
bioRxiv - Microbiology 2023Quote: ... and AgeI-HF (NEB Cat#: R3552L), and the 11.787 kb backbone fragment was isolated by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... and EcoRI (NEB Cat#: R3101S) in 1x CutSmart buffer (NEB Cat# ...
-
bioRxiv - Microbiology 2023Quote: ... Protoscript II (NEB) and 0.1M DTT ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product and pLV IRES-Hygro plasmid backbone were assembled using HiFi DNA Assembly Master Mix (NEB Cat#: M5520AA) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... RNA purification by NEB kit ...
-
bioRxiv - Microbiology 2023Quote: ... and DNase was removed using the Monarch RNA Cleanup Kit (50 µg; New England Biolabs). LunaScript RT SuperMix Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Reagents and enzymes were supplied by New England Biolabs (NEB), Merck and Thermo-Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...
-
bioRxiv - Microbiology 2023Quote: ... by HiFi DNA assembly (New England Biolabs). NPTII expression cassette was amplified using pII99 plasmid (Namiki et al. ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR reactions were performed on an Applied Biosystems 7500 Real-Time PCR system using the Luna Universal qPCR MasterMix (New England Biolabs) with the primers listed in Table S4 ...
-
bioRxiv - Microbiology 2023Quote: ... IVT-mRNAs were then purified using a Monarch RNA clean up kit (New England Biolabs, Ipswich, MA, USA), and the quality of purified IVT-mRNAs was assessed by non-denaturing agarose gel electrophoresis using RNA High for Easy Electrophoresis (DynaMarker Laboratory ...