Labshake search
Citations for New England Biolabs :
8651 - 8700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was used for PCR with primers nCoV-96_L/nCoV-96_R (Table S4) and Q5 polymerase (NEB). DNA was purified using magnetic beads (Omega Bio-tek ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with T4 RNA ligase 2 was performed in 1x T4 Rnl2 (NEB) supplemented with PEG 8000 (10% ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM MgCl2) supplemented with 1 mM ATP and 1 U/μL RNase Inhibitor (NEB). Reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was purified with Monarch RNA Cleanup kit (NEB). PNK-treated and non-treated RNAs were annealed to splints (1:1 ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was treated with T4 PNK (NEB) for 1 hour at 37°C and purified with RNAClean XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse-transcribed using LunaScript® RT SuperMix Kit (NEB). Diluted cDNA (100-fold ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 2.5 µL aliquot of the samples was taken for qPCR to check the number of cycles using the NEB Luna 2x mix (New England Biolabs, Ipswich, MA). After completing the required number of additional PCR cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation primers specific to the 5′ and 3′ RNA adapter sequence were synthesized (Table S1) and the whole cDNA was PCR amplified using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes [16] ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with DnaseI (NEB, M0303L). We used 150 ng of RNA as input for preparing 3’ RNA sequencing libraries following CelSeq2 protocol (97,98) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL T4 DNA polymerase (New England Biolabs, Ipswich, MA) and 2.5 µL Ampligase (Biozym ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.2% Tween-20) and RNA 5’ ends where labelled with [γ-32P]-ATP and T4 PNK (NEB, M0201L) at 37°C for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tagmented samples were amplified by the addition of 2.5 µL each of 10 µM barcoded forward and reverse primers (Picelli et al., 2014) (Picelli et al., 2014) and 15 µL Q5 2x HiFI MasterMix (New England Biolabs) using the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome were amplified using the high-fidelity proofreading enzyme Q5® High-Fidelity DNA Polymerase (NEB, M0491L) in a 25 µL reaction volume using respective primers (fig ...
-
bioRxiv - Molecular Biology 2023Quote: RNA-seq libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing libraries were quantified by qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA extraction was performed using TRI reagent (Cosmo Bio Co., Ltd., Tokyo, Japan) and the Monarch Total RNA Miniprep Kit (New England BioLabs Inc., Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatants were treated with DNase I (New England Biolabs, MA, USA), and encapsidated viral DNA was extracted from the supernatants using the QIAamp DNA Blood mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified oligo pools were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and transformed into Dh5A high-efficiency competent cells (NEB). Transformed cells were spread on Ampicillin plates to achieve ∼50,000 individual clones (7-8 individual transformations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were constructed from 800 ng total RNA (NEBNext Multiplex Small RNA library prep set for Illumina, New England Biolabs, NEB-E7560S) and the small RNA fraction was sequenced on the NextSeq 500 System (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1,2 U β-agarase (NEB, M0392) per mL MES buffer was added to the solution and incubated at 42 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: BL21-DE3 cells (New England Biolabs) were transformed with pET-His6-MBP-TEV-dFMRP and protein expression induced by incubation with IPTG ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries for small RNA-seq were prepared using NEB Next® Multiplex Small RNA kit (New England Biolabs), and the libraries were sequenced by NovaSeq 6000 system (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... the NEBuilder HiFi Master Mix was used according to kit instructions (E5520S, New England Biolabs). All single integration plasmids were digested with PmeI before transformations and integrations were verified by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Molecular Biology 2023Quote: ... All enzymes were purchased from Thermo Fisher Scientific (except for SrfI, which was from New England Biolabs). Cloning was performed in the E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were dephosphorylated with 20 units Shrimp Alkaline Phosphatase (rSAP, M0371, New England Biolabs) for 1 hour at 37°C with 1 μl RNaseOUT (10777019 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was then reverse-transcribed for 30[min at 50°C using ProtoScript II (New England Biolabs) with a primer (5′-Phos-NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG-iSp18-GTGACTGGA GTTCAGACGTGTGCTC-3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA adaptor provided by the kit was phosphorylated on its 5’ end using T4 Polynucleotide Kinase (NEB). RNA (1 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S), and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S) ...
-
An updated C. elegans nuclear body muscle transcriptome for studies in muscle formation and functionbioRxiv - Genetics 2023Quote: ... then 465ng of immunoprecipitated RNA was polyuridylated (New England Biolabs, cat no. M0337S) and reverse transcribed (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770L). NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... library preparation was done using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB E7490L) integrated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770L) ...
-
bioRxiv - Cancer Biology 2023Quote: ... library preparation was performed using NEBnext single-cell/low input RNA library prep kit (E6420L, NEB). For NKX2.2 CRISPR experiments ...
-
bioRxiv - Biochemistry 2023Quote: Site directed mutagenesis for I72W M.TaqI mutation on M.TaqI plasmid a was carried out using Q5 Site-Directed Mutagenesis Kit (NEB) by following kit protocol and expressed ...
-
bioRxiv - Microbiology 2023Quote: ... pLENTI-CMV-GPRC5A was mutated to remove m6A sites (A57G, G120T, C174T, A264G) using Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA immunoprecipitations and inputs were converted to cDNA using LunaScript RT SuperMix Kit (NEB). m6A-immunoprecipitated samples were normalised to their respective input samples and m6A content at a particular region calculated relative to an unmodified control region within the same transcript.
-
bioRxiv - Microbiology 2023Quote: ... and cDNA was generated using an AMV first strand cDNA synthesis kit (New England Biolabs, Catalog # E6550). The segment was amplified through PCR with PstI and BamHI restriction sites incorporated onto the double-stranded cDNA using specific primers (PstI-VIGS-F and BamHI-VIGS-R ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA was amplified using an AMV first strand cDNA synthesis kit and was normalized to 50 ng/ul for each sample (New England Biolabs, Catalog # E6550). Sslac2 was amplified using specific detection primers (Sslac2 Det F and R ...
-
bioRxiv - Physiology 2023Quote: ... and mRNA was isolated and library prepped using the NEB Directional RNA sequencing kit (E7765L, New England Biolabs) with the PolyA purification bundle (E7490L ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The poly(A) mRNA isolation was performed using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB). The mRNA fragmentation and priming were performed using NEBNext First Strand Synthesis Reaction Buffer and NEBNext Random Primers ...
-
bioRxiv - Neuroscience 2023Quote: Syt-1 fragments were produced in NEB-Express (NEB), while nanobodies were produced in SHuffle® Express (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... while nanobodies were produced in SHuffle® Express (NEB). Bacteria were grown on terrific broth supplemented with kanamycin at 37°C for Syt-1 and 30°C for nanobodies ...
-
bioRxiv - Neuroscience 2023Quote: ... or Q5 (New England Biolabs, #M0491S) high-fidelity proof-reading DNA polymerases were utilized for all PCR-based cloning steps ...
-
bioRxiv - Neuroscience 2023Quote: ... TRIM71-R608H expression plasmid was generated by cloning DNA fragment-R608H (Integrated DNA Technology) (table S5) into pCDH-EF1a-3xHA-TRIM71-T2A-mCherry plasmid using SmaI (NEB, no. R0141) and EcoRI-HF (NEB ...