Labshake search
Citations for New England Biolabs :
8601 - 8650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... using NEBuilder HiFi cloning (New England Biolabs). Cells were treated at 60% confluence with lentivirus for 5 to 24 hours ...
-
bioRxiv - Genetics 2023Quote: ... Whole genome sequencing libraries were prepared using the NEBNext Ultra II Library kit (New England Biolabs, E7645L) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... An NEB Monarch RNA Extraction Kit (New England BioLabs) was used according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL of Monarch RNase A (New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2023Quote: ... Paired-end libraries were constructed using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, E7645S) using a starting material of 50 ng ...
-
bioRxiv - Immunology 2023Quote: ... The pure genomic DNA was separated from any extrachromosomal vaccine DNA by 2D gel electrophoresis and further digested by the AscI restriction Enzyme (R0558S, NEB) since it cuts only DNA propagated in E ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were isolated from selected transformants using Monarch plasmid miniprep kit (NEB) and subjected to sequencing reactions (Eurofins ...
-
bioRxiv - Microbiology 2023Quote: Phusion High-Fidelity DNA Polymerase (New England Biolabs) and primers W3394 and W3395 were used to PCR-amplify pitA from Salmonella enterica 14028s chromosome ...
-
bioRxiv - Microbiology 2023Quote: ... Extracted pJES002 and pOXC102 (33) were digested using AscI and BamHI-HF (New England Biolabs), and the plasmid backbone of pJES002 and a tac promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... ligated into Bbs1 digested pX330 using Quick Ligase (NEB). pX330 plasmids were transformed into NEB Stable competent cells ...
-
bioRxiv - Cell Biology 2023Quote: ... gel extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Systems Biology 2023Quote: Library construction was carried out using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645S, NEB). 4ng of fragmented DNA was used for end-repair/A-tailing ...
-
bioRxiv - Developmental Biology 2023Quote: ... All sequences were verified by Sanger sequencing and linearized with Apa1 (New England BioLabs #R0114S) to generate mRNAs (used at 25-150ng/µl) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Shrimp Alkaline Phosphatase (NEB), 10 mM dNTP (Promega) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The RNA was then end-repaired and poly(A) tailed on-bead by treatment first with T4 PNK (NEB) and then treatment with yeast poly(A ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was performed using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S) according to the manual of the kit ...
-
bioRxiv - Cell Biology 2023Quote: cDNA encoding recombinant MUC17(7TR) with N-terminal 3xFlag tag was generated using Gibson Assembly (E2611S, NEB) following the manufactures protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and ligated using NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S) with 1:3 vector:insert mass ratio calculated by NEBioCalculator (https://nebiocalculator.neb.com/#!/ligation) ...
-
bioRxiv - Cell Biology 2023Quote: ... and T4 DNA ligase (NEB, M0202S). For the NEFL knock-in repair template ...
-
bioRxiv - Cell Biology 2023Quote: ... treated with USER enzyme (NEB) and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.0 U T5 exonuclease (New England Biolabs), 12.5 U Phusion DNA polymerase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB) to screen for possible edited clones ...
-
bioRxiv - Immunology 2023Quote: ... and 100-200ng were PCR amplified using Q5 Hot Start High Fidelity 2x Master Mix (NEB) and 10µM forward/reverse primers flanking the region of interest ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced on an Illumina NextSeq 550® (New England Biolabs, Ipswich, MA, USA) device using 300 cycles and a paired-end approach.
-
bioRxiv - Genomics 2023Quote: ... 1 U/µl T4 Rnl2 (NEB #M0239), 1 U/µl RNase Inhibitor (BLIRT #RT35 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... reverse transcription from mRNA was performed using the LunaScript® RT SuperMix Kit (New England BioLabs) following standard protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutations were introduced using the Q5® site-directed mutagenesis kit (New England BioLabs) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Microbiology 2023Quote: ... All enzymes for DNA amplification (PHUSION® polymerase) and plasmid construction (restriction enzymes, T4-DNA ligase and Quick CIP) were obtained from New England Biolabs (NEB) and used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... were assembled by hybridisation of complementary oligonucleotides with one oligonucleotide being radiolabelled with [γ-32P]-ATP by T4 polynucleotide kinase (NEB). 15 µl EMSA samples contained 800 pM DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... and T4 ligase (NEB, M0202S). The parental plasmid was digested with 5U DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid transformation was achieved by using the heat shock method (42°C, 47s) in DH5α competent cells (NEB, C2987H), then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers listed in Table S8, then inserted into PHR-mCh- CryWT plasmid (Adgene, 101221) by using NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The generated constructs were fully sequenced to confirm the absence of any mutations or stop codons ...
-
bioRxiv - Molecular Biology 2023Quote: ... pCMV3-hSSB1-GFP plasmid from Sino Biological (HG22790-ACG-SIB-1Unit) was amplified with Q5® Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) with primers listed in Table S7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The parental plasmid was digested with 5U DpnI (NEB, R0176S). Plasmid transformation was achieved by using the heat shock method (42°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... A NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs) was used according to the manufacturer’s instructions for sample library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments of the nucleosome library present in each section were amplified via PCR (NEB Taq Polymerase) by using as primers the sequences of the Asc1 and BamH1 adapters described in Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µL Q5 Hot Start 2x MasterMix (New England Biolabs, Ipswich, MA), and 0.5 µL 10 µM 5’ Bio-ISPCR oligo ([Btn]AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli polyA polymerase (NEB), and RNA was cleaned up again using RNAClean XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with RtcB was performed in 1X RtcB reaction buffer (NEB) supplemented with GTP (0.1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... A CRISPR array containing two repeats and one spacer targeting the gfp gene of recombinant Sindbis virus (SINV-GFP) was generated by annealing and extending two partially complementary DNA oligos with Q5 polymerase (NEB) (Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified with Monarch RNA Cleanup kit (NEB). RNA concentration was measured using Nanodrop ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transcribed RNAs were purified using the Monarch RNA Cleanup kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... One part of RNA was treated with T4 PNK (NEB) in a reaction buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA cleavage products were purified using Monarch RNA Cleanup kit (NEB) and divided into two parts ...
-
bioRxiv - Molecular Biology 2023Quote: ... T4 RNA ligase 1 was mixed with splinted RNA in a 1x T4 Rnl buffer (NEB) supplemented with ATP (1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA cleavage fragments were purified with Monarch RNA Cleanup kit (NEB). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... Diluted cDNA (100-fold) was used for two multiplex PCR reactions with Q5 polymerase (NEB) with two primer pools (Table S5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse transcribed using LunaScript® RT SuperMix Kit (NEB), and cDNA was used for PCR with primers nCoV-96_L/nCoV-96_R (Table S4 ...