Labshake search
Citations for New England Biolabs :
8851 - 8900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Vector and insert were ligated overnight at 16°C using T4 DNA ligase (New England Biolabs) and transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Bioengineering 2023Quote: ... T4 Ligase and low molecular-weight DNA ladder were obtained from New England Biolabs (NEB). Methyltetrazine DBCO ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Bioengineering 2023Quote: ... or NEB Stable (NEB cat. no. C3040) E ...
-
bioRxiv - Bioengineering 2023Quote: NEB Turbo (NEB cat. no. C2984), NEB 10-beta (NEB cat ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were assembled using the HiFi DNA Assembly kit (NEB, cat #E2621) from degenerate UltramerTM oligos (IDT) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were constructed using scarless assembly reactions to insert oligos into plasmid backbones (BbsI-HF-v2, 1X T4 DNA ligase buffer, T4 DNA ligase; NEB). For amino acids with six synonymous codons (leucine ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Discrete strains were assembled using the HiFi DNA Assembly kit (NEB, cat #E2621) from IDT gBlocks ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Discrete plasmids were constructed using the HiFi DNA Assembly kit (NEB, cat #E2621) to insert synthetic genes (IDT gBlocks or eBlocks ...
-
bioRxiv - Plant Biology 2023Quote: ... Site directed mutagenesis of MLO2CT was performed by Gibson assembly (Gibson et al. 2009) based on suitable PCR fragments generated with Phusion® high-fidelity DNA polymerase (NEB GmbH, Frankfurt, Germany). The CAM2 coding sequence was inserted as an NcoI/XhoI DNA fragment into modified pET28a vector that lacks the N-terminal His6 tag (previously designated pETλHIS ...
-
bioRxiv - Plant Biology 2023Quote: ... using Phusion DNA polymerase (NEB) and the primers (FOR 5’CTTAATTAATTAAAAGACAACAACGACCTGAATCT3’ and BACK 5’ CATGGCGCGCCCTCGAGGCCTCTTTTTACCATGTTG3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... which was accomplished by using micrococcal nuclease (MNase, New England Biolabs) instead of sonication.
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and T4-DNA Ligase (both NEB). In level 1 and 2 plasmids the cloning site for the ORF disrupts the mCherry gene ...
-
bioRxiv - Plant Biology 2023Quote: ... with the native ACO2 promoter using Gibson Assembly® (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cas9 expression vector by golden-gate assembly with BbsI-HF (New England Biolabs, R3539L)33,34 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coli (New England Biolabs, Cat. #C3040H) was transformed with 2 μL of each ligation reaction and resulting colonies were selected for plasmid DNA isolation using the ZymoPure Plasmid miniprep kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: ... the difference sequences were assembled using NEBuilder HiFi DNA Assembly (New England BioLabs, E2621). For BiTE molecules ...
-
bioRxiv - Microbiology 2023Quote: ... 0.37 U murine RNase inhibitor (NEB) and 0.69 μM ModB at 15 °C ...
-
bioRxiv - Genetics 2023Quote: ... and adaptor ligation (New England BioLabs). The final products were TA cloned and analyzed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Constructs were made using Gibson Assembly (NEB Inc., MA) and confirmed by sequencing ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by reverse transcription using Protoscript II (New England Biolabs, M0368L) and circularization of cDNA using CircLigase ssDNA Ligase (Epicenter ...
-
Deletion of MEC1 suppresses replicative senescence of the cdc13-2 mutant in Saccharomyces cerevisiaebioRxiv - Molecular Biology 2023Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, cat. no.: E0554S). The mutations were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Systems Biology 2023Quote: ... coli cells (New England Biolabs). Protein expression was induced at OD600 nm 0.6 - 0.8 with 1 mM IPTG overnight at 18°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and BlpI (R0585S, NEB) restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... coli strain (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... Gαi2R179C and GαoAR243H mutants were constructed using pcDNA3.1 wild-type human ee-tagged-Gαi2- and ee-tagged-GαoA plasmids as template (cDNA Resource Center) and Q5 Site-directed mutagenesis kit (New England BioLabs). The lentiviral vector for tetracycline-inducible expression of the Gαi2R179C and GαoAR243H mutants was constructed by first cloning Gαi2R179C and GαoAR243H from pcDNA3.1 to pENTR vector (Thermofisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coli DH5α competent cells (NEB #C2987H) and purified (Qiagen #12165) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Colony PCR was performed using Quick-Load Taq 2X master mix (New England Biolabs, M0271L). Successful colonies were grown in 100 μg/mL ampicillin-rich lysogeny broth (LB ...
-
bioRxiv - Systems Biology 2023Quote: ... gDNA was amplified by PCR with Phusion polymerase (NEB) using primers CAAGCAGAAGACGGCATACGAGAT -i7 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACTGCTAGCTAGATGACTAAACGCG and AATGATACGGCGACCACCGAGATCTACAC - i5 - ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGTCTGGATCCACCGGTCC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1 µL DpnI (New England Biolabs, Ipswich, MA) was added per 50 µL of PCR reaction and the reaction was incubated at 37°C for 2 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the 700 base pair genomic region directly upstream from the target gene’s start codon and the 700 base pair genomic region directly downstream from the target gene’s stop codon were cloned in tandem into the pKOS6b plasmid cut with XbaI using Gibson assembly43 (E2611, New England Biolabs, Ipswich, MA). For insertion of promoter regions ...
-
bioRxiv - Synthetic Biology 2023Quote: The successfully cloned plasmids were digested with PmeI restriction enzyme (New England Biolabs) to linearize prior cell transformations into either W303 or YPH499 (MATa ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into the gel-purified C-terminal sub-cloning vector digested with EcoRI and KpnI restriction enzymes (New England Biolabs). Reaction products were transformed into chemically competent Top10 Escherichia coli cells and selected on LB-agar plates with carbenicillin at 37 °C static conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... blunting (Quick Blunting kit, NEB), and re-ligating using T4 DNA Ligase (NEB).
-
bioRxiv - Plant Biology 2023Quote: ... Target loci were amplified using a proof-reading polymerase (Q5® High-Fidelity DNA Polymerase, New England Biolabs, Ipswich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Reactions were purified according to the ssDNA cleanup protocol from the Monarch PCR cleanup kit (New England Biolabs; T1030L).
-
bioRxiv - Plant Biology 2023Quote: ... Fragments were isolated by PCR amplification using Phusion® High-Fidelity DNA Polymerase (NEB) from Col-0 genomic DNA/cDNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli and grown at 30°C to ensure construct stability (New England Biolabs). Plasmid clones were picked and inoculated into liquid LB media for overnight culture followed by miniprep using the PureLink Plasmid MiniPrep Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... The domain swap constructs were assembled using the NEBuilder HiFi DNA assembly kit (NEB). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were prepared with Phusion High-Fidelity DNA Polymerase (NEB) in a system containing 12.5 µl 2x Phusion ...
-
bioRxiv - Neuroscience 2023Quote: ... Complementary DNA was synthesized from 20-60 ng of RNA using the ProtoScriptII First Strand cDNA Synthesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... unless the use of Dam/Dcm-deficient (dam-dcm- E.coli) bacteria (New England Biolabs) is specifically indicated.
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...