Labshake search
Citations for New England Biolabs :
7701 - 7750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 units of PstI-HF (New England Biolabs, R3140L) plus 200 units of NheI-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plugs were washed in 20 ml of Milli-Q water for 30 minutes and then 10 ml of 1x rCutSmart buffer (New England Biolabs, B6004S) for 1 hour followed by a further hour in 5 ml of 1x rCutSmart buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... plus 200 units of NheI-HF (New England Biolabs, R3131L), and 20 µl of RNase A (100 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... Large (Klenow) Fragment (New England BioLabs, M0210L). pLX32 is a derivative of pMZ283 (Addgene plasmid ID ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Molecular Biology 2023Quote: ... restriction digestion with MboI (New England Biolabs France, R0147M) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Molecular Biology 2023Quote: ... A second digestion was performed by resuspending previous 3C DNA template in 1X RE buffer and incubating with NlaIII (NEB, R0125) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... un-ligated fragment ends were removed by incubating with T4 DNA Polymerase (NEB, M0203), dATP and dGTP for 4 hrs at 20°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The recipient vector was dephosphorylated with shrimp alkaline phosphatase (rSAP NEB #M0371S) during the digest ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plugs were then equilibrated twice for 30 min at room temperature in 1 ml of 1x NEBuffer 3.1 (New England Biolabs). After the buffer was completely discarded ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2 μg of sheared genomic DNA was repaired and end-prepped with NEBNext FFPE DNA Repair Mix and Ultra II End-prep enzyme mix (NEB) for 15 minutes at 20°C followed by 5 minutes at 65°C for inactivation of the enzymes and purified with 1X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1D2 Adapters (ONT, Oxford, UK) and Quick T4 DNA Ligase (NEB) were added and incubated for 10 minutes at room temperature and purified with 0.4X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... between 0.9 and 1.8 μg of each type of genomic DNA was repaired and end-prepped with NEBNext FFPE DNA Repair Mix and Ultra II End-prep enzyme mix (NEB) for 5 minutes at 20°C followed by 5 minutes at 65°C for inactivation of the enzymes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25 µl of NEBNext HiFi 2x PCR Master Mix (New England BioLabs) was mixed with 21 µl of the CUT&Tag DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with XRN-1 and RppH (NEB #M0356S) together ...
-
bioRxiv - Molecular Biology 2023Quote: ... MeDIP-seq libraries were prepared with NEBNext Ultra II DNA Library Prep Kit (NEB, E7645L). Next generation sequencing was performed on NextSeq 2000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digested DNA fragments were filled in with biotin-labeled dATP by incubating with Klenow enzyme (NEB, M0212), biotin-14-dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was captured using RNA purification beads (NEB). The eluted mRNA was fragmented and denatured for first and second strand synthesis for conversion into cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were digested with Hpy166II (R0616S, NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... The amplicon was digested with the restriction enzyme CviQI according to manufacturer’s instructions (New England Biolabs). The enzyme digested the 119nt amplicon from the Z allele to produce fragments of 43 and 76nt ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... The PCR products were treated with exonuclease I (Biolabs, M0293S) and were subjected to Sanger Sequencing using the forward primer and analyzed by the TIDE method (68) ...
-
bioRxiv - Cell Biology 2023Quote: All plasmids used in this study were constructed using the NEBulider (New England Biolabs, Ipswich, USA; Cat #E2621L) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... coli (New England Biolabs) was transformed with the resultant DNA of the In-Fusion reaction by GenePulserII (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2023Quote: ... an NEB Q5 SDM kit (NEB, E0554S) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared with 0.1-1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalogue #E6560L) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Cell Biology 2023Quote: ... via digestion with NheI and MluI in CutSmart buffer (New England Biolabs). The HA-hTRIM28 construct was then ligated into the multiple cloning site (MCS ...
-
bioRxiv - Genomics 2023Quote: ... The sample was lysed in HiChIP lysis buffer and digested with MboI (NEB) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... and mRNA was isolated with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L). RNA integrity number (RIN ...
-
bioRxiv - Genomics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1) (New England BioLabs E7416). DNA libraries were quality checked with DNA 1000 assay (Aligent 5067-1504 ...
-
bioRxiv - Genomics 2023Quote: ... The poly-A+ fraction of RNA was isolated using Oligo d(T)25 Magnetic Beads (New England BioLabs Inc.) following the commercial protocol for Mammalian Cells provided by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: Immuno-precipitated DNA samples at an input amount of 2-100 ng were subjected to Illumina fragment library preparation using the NEBnext Ultra II DNA library preparation chemistry (New England Biolabs, E7370L). In brief ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries for Next Generation Sequencing were prepared with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs E7775) and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Genomics 2023Quote: ... and for tissue (NEB T3060L), following manufacturer’s instructions and introducing few technical improvements ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA or immunoprecipitated RNA (MIWI or MILI) was de-phosphorylated with Shrimp Alkaline Phosphatase (M0371, NEB) and end-labeled using T4 polynucleotide kinase (M0201 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Developmental Biology 2023Quote: ... WGA DNA was subsequently processed for Illumina library sequencing preparation using TruSeq indexing of the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). NEBNext Multiplex Oligos for Illumina (96 index primers ...
-
bioRxiv - Developmental Biology 2023Quote: Small RNA libraries from immunoprecipitated RNAs or total RNA were prepared using Small RNA Library Prep Kit (E7300, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... pHia5ET was transformed into T7 Express lysY/Iq Escherichia coli cells (NEB C3013I). Overnight cultures were added to two 1 L cultures of LB medium supplemented with 50 µg/mL kanamycin and grown with shaking at 37°C to an OD600 of 0.8-1.0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, #E7645S) and sequenced on an Illumina HiSeq 3000 platform to generate a minimum of 20 million 150-bp reads per sample.
-
bioRxiv - Cell Biology 2023Quote: ... site-directed mutagenesis was done using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) as directed by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The obtained inserts and mCherry-N1 were digested with restriction enzymes (NheI and EcoRI, New England Biolabs) then ligated with T4 DNA ligase (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were constructed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs, #E7760S) and sequenced on an Illumina NextSeq2000 platform to generate a minimum of 25-30 million 150-bp paired-end reads per sample.
-
bioRxiv - Genomics 2023Quote: ... 3.5 µl of Klenow Fragment (NEB) was added and incubated at 37℃ for 2 hours.