Labshake search
Citations for New England Biolabs :
7651 - 7700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The fragment was amplified using Q5® DNA polymerase (NEB) and primers DRsqnH-upSpeI/DRsqnI-downSpeI with a 61-68°C gradient annealing temperature (Bio-Rad S1000 thermocycler) ...
-
bioRxiv - Microbiology 2023Quote: ... The fragment was cloned by Gibson Assembly (New England Biolabs; Ipswich, MA, USA) into ptetO7sag4-HA-CEP250-DHFR-TS ...
-
bioRxiv - Molecular Biology 2023Quote: Endpoint PCR was performed in a 20 µL reaction volume containing 1× OneTaq Master Mix (NEB), 0.2 µM of each primer and 1 µL of 100-fold diluted cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli (C3010, NEB). Bacteria were grown overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by RNA purification using the Monarch RNA Cleanup Kit (NEB). Purified RNA was stored at −80 °C ...
-
bioRxiv - Molecular Biology 2023Quote: 7.5ug of total RNA was immunoprecipitated for m6A with EpiMark® N6-Methyladenosine Enrichment Kit (NEB) following the manufacture protocol with 10% of the sample RNA taken as input prior to the pulldown ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed in a 50 μl volume containing Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). Quantitative analysis of the purified libraries was performed using Qubit 3.0 Fluorometer and Qubit® dsDNA HS Assay kit (InvitrogenTM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... ONT sequencing adapters (SQK-LSK114) were then ligated onto the amplicons (NEB Quick T4 DNA Ligase) and purified with AMPure-XP beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Successful reactions were directly incubated at 37 °C with 1 µL of DpnI (NEB, #R0176L) for 30 min to 3 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.625 µL of Phusion Polymerase (2,000 U/mL, NEB, #M0530L). The thermal cycling program consisted of an initial 3 min at 98 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Seven µL of DNA product was circularized in a reaction with 1 µL of 10X T4 DNA Ligase Reaction Buffer (NEB, #B0202A), 1 µL T4 Ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli RNA polymerase holoenzyme (NEB, #M0551S). Either 1 mM of NaCl or NaF was also included depending on the experimental conditions ...
-
bioRxiv - Molecular Biology 2023Quote: Wild‐type λ‐DNA was purchased from NEB. For generation of 2x T7‐4xCBSs λ‐DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA was reverse transcribed using LunaScript reverse transcriptase (New England Biolabs, Ipswich, MA), random hexamer primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Isolated RNA was treated with DNaseI (New England Biolabs, Ipswich, Massachusetts) and subsequently purified by phenol:chloroform ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was then used for PCR with the OneTaq 2x Master mix with Standard Buffer (New England Biolabs, Ipswich, Massachusetts). Targets for differential editing of the mutant in p150 and p110 were ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 1 U of T7 endonuclease 1 (New England Biolabs) and NEB Buffer 2 were added ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... EcoRI (NEB, Cat# R0101L), BsrgI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Phusion High-Fidelity DNA Polymerase kits (New England BioLabs, Ipswich, MA) were used to amplify diagnostic regions of DNA for species identification ...
-
bioRxiv - Microbiology 2023Quote: ... The template was digested with DpnI (NEB) and the new viral genome was transformed into bacteria ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 mutant constructs containing point mutations and deletions used in this study were generated by SDM using Q5 polymerase (New England Biolabs) and primers listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of the PCR product was added directly to a 50 μL in vitro transcription reaction with T7 RNA Polymerase (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions and incubated for 3h at 37 ℃ ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosome foot-printing was performed by adding 1.25U/μl RNase I (NEB Catalog# M0243L) to 400 μL clarified lysate and incubating samples on rotator mixer for 45min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2023Quote: ... For RNase H (NEB # M0297S) or RNase A (Sigma #R6148 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq samples were prepared with single index primers (NEB ME6609S). RNA integrity and and concentration of amplified libraries was assessed with the Bioanalyzer and Qubit ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLenti-PGK-ATP6V1H(Δ176-191)-FLAG-Puro was produced using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). M4P-EGFP-LC3B and pOGP were kind gifts from F ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP (NEB) in a total volume of 25 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was digested with DpnII restriction enzyme (NEB) and religated with T4 DNA HC ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... used in T7 endonuclease I activity assays (NEB E3321) as previously described (Baker et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The R119G and T82I point mutations were added to the parent AID* construct using the Q5 Site-Directed Mutagenesis Kit (NEB, Cat # E0554S).
-
bioRxiv - Biochemistry 2023Quote: ... The final plasmids were then constructed using Gibson Assembly Master Mix (NEB, Cat # E2611S), merging the amplified gene fragments with the NotI/XmaI digested parent vector.
-
bioRxiv - Microbiology 2023Quote: ... Libraries for sequencing were prepared using a NEBNext Ultra II FS DNA library prep kit for Illumina modules E7810L and E7595L (New England BioLabs) by the manufacturer’s protocol (DNA input ≥100 ng ...
-
bioRxiv - Microbiology 2023Quote: ... Prepared libraries were quantified using a NEBNext Library Quant kit for Illumina E7630L (New England BioLabs) and pooled with volumes adjusted to normalize concentrations aiming for ∼700-fold genomic coverage for population samples or ∼200-fold genomic coverage for clones ...
-
bioRxiv - Plant Biology 2023Quote: ... Adapter Mix II (ONT, Oxford, UK), ONT Ligation Buffer (ONT, Oxford, UK) and Quick T4 DNA Ligase (NEB) were added and incubated for 10 minutes at room temperature and purified with 0.4X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2023Quote: ... Adapter Mix II (ONT, Oxford, UK) and Quick T4 DNA Ligase (NEB) were added and incubated for 10 minutes at room temperature and purified with 0.5X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1D2 Adapters (ONT, Oxford, UK) and Quick T4 DNA Ligase (NEB) were added and incubated for 10 minutes at room temperature and purified with 0.4X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... The genomic DNA was barcoded, adding Native Barcoding Expansion (ONT, Oxford, UK) and Blunt/TA ligase mix (NEB) was added for 10 minutes at room temperature and purified with 1X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2 μg of sheared genomic DNA was repaired and end-prepped with NEBNext FFPE DNA Repair Mix and Ultra II End-prep enzyme mix (NEB) for 15 minutes at 20°C followed by 5 minutes at 65°C for inactivation of the enzymes and purified with 1X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1D2 Adapters (ONT, Oxford, UK) and Quick T4 DNA Ligase (NEB) were added and incubated for 10 minutes at room temperature and purified with 0.4X AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2023Quote: ... between 0.9 and 1.8 μg of each type of genomic DNA was repaired and end-prepped with NEBNext FFPE DNA Repair Mix and Ultra II End-prep enzyme mix (NEB) for 5 minutes at 20°C followed by 5 minutes at 65°C for inactivation of the enzymes ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: ... and combined in an assembly reaction (NEB, Ipswitch, MA, Cat. No. 2621) to create a donor vector for genomic modification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A genomic library was prepared using the NEBNext Ultra DNA Library Prep Kit (New England BioLabs) and sequenced on an Illumina NovaSeq (S4 Flow Cell ...
-
bioRxiv - Molecular Biology 2023Quote: ... Phage samples were pre-treated with 2.5 μL of DNase I (2,000 units/mL, NEB), 2.5 mM MgCl2 and 0.5 mM CaCl2 in 200 μL of each diluted concentration of phage samples at 37 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... with XRN-1 (NEB #M0338S) alone ...