Labshake search
Citations for New England Biolabs :
6951 - 7000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... qRT-PCR was performed using LUNA SYBR (NEB) on a Rotorgene (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: Nuclear RNA-seq libraries were prepared from DNA-free nuclear RNA using NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB) after first depleting rRNA using the NEBNext® rRNA Depletion Kit v2 (Human/Mouse/Rat) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The L3 linker was then ligated to the 3′ RNA ends (with NEB HC RNA Ligase in ligation buffer (200 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... The transposon DNA was purified by digesting pCML375 using PvuII-HF (NEB), and transposomes were generated following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA and annealed gRNA oligos were ligated using T4 DNA ligase (NEB). Constructs were validated using Sanger sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 Endonuclease 1 (T7E1) enzyme (NEB) was added and incubated at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X NEB buffer 2 (NEB) was added to 200 ng DNA and PCR products were denatured to single strands by heating at 95°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: pX458 plasmid was digested with BbsI-HF (NEB) DNA and annealed gRNA oligos were ligated using T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: PCR products amplifying the C-terminal region of CBP in both edited and unedited cells were cleaned up using the Monarch PCR cleanup kit (NEB). DNA concentrations were measured using the Qubit dsDNA BR kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10X T4 ligation buffer (NEB) containing essential ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were prepared using NEBNext UltraTMII DNA Library Prep Kit for Illumina (NEB, E7645) following manufacturers instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... All restriction enzymes were purchased from New England Biolabs (NEB) and digestion reactions performed according to manufacturer protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were then incubated overnight with Exonuclease III (NEB) to eliminate unligated species ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 Ligase (NEB) at 5 U/µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... SYBR green assay was used to determine HBV pregenomic expression (Luna Universal qPCR Master Mix, New England Biolabs, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... and in vitro transcribed RNA was purified using the using the Monarch® RNA Cleanup Kit (NEB). Full-length 5’ RACE was performed using the GeneRacer™ with Superscript™ III RT kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 units XhoI (New England Biolabs), primers for target and reference at 900 nM and probes at 250 nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysates from HEK293T transfections performed on two separate days were used as template for genomic PCR using the Q5 polymerase (NEB) and visualized on a 2% agarose gel.
-
bioRxiv - Molecular Biology 2024Quote: ... Digested vectors to be used in ligation reactions were treated with recombinant shrimp alkaline phosphatase (NEB, M0371). PCR fragments and digested vectors were purified using GeneJET PCR Cleanup Kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.2 mM dCTP and 2 U of terminal transferase (New England Biolabs). The mix was incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Fragments were then ligated with Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix #E2621L, NEB).
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4 U/µL RNase Inhibitor (Murine) (NEB, M0314S). The reaction was started by adding K2IrBr6 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... Linearized DNAs were used as templates for in vitro transcription of capped RNAs with HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs) in the presence of CleanCap® Reagent AU (TriLink Biotechnologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S, T1030S).
-
bioRxiv - Molecular Biology 2024Quote: Plasmids (pBluescript KS+, pBS hereon) for HiBit-tagged POI mRNA were generated by Gibson Assembly (Gibson Assembly cloning kit, NEB, E5510S) or restriction digest cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... All PCRs were performed with Q5 High-Fidelity DNA Polymerase (NEB, M0491S) and digested with DpnI (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was cloned into the pBS backbone by restriction digest and ligation using T4 DNA ligase (NEB, M0202S). For the construct with a structured 5’UTR (5’UTR-Hairpin) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with DpnI (NEB, R0176S). PCR and digest products were purified using Monarch DNA Gel Extraction and PCR and DNA Clean Up Kits (NEB T1020S ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were generated using either standard restriction-ligation or assembled using the Gibson Assembly Master Mix (NEB) or In Vivo Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Microbiology 2024Quote: ... coli isolates was purified using a Monarch DNA purification kit (New England Biolabs Japan Inc., Tokyo, Japan). DNA concentrations were measured using Qubit™ 4 fluorometer with Qubit™ 1× dsDNA High Sensitivity (HS ...
-
bioRxiv - Microbiology 2024Quote: ... the kanamycin resistance cassette could be removed by restriction digestion and a respective PCR fragment containing the E T9I mutation and with overlapping ends was introduced by Gibson assembly using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621). This PCR fragment was amplified using cDNA from a patient sample containing the E T9I mutation with the primers Efwd gcacaagctgatgagtacgaactt and Erev gaaaaactaatataatatttagttcg ...
-
bioRxiv - Microbiology 2024Quote: ... using oligo d(T)23 VN (NEB) primers.
-
bioRxiv - Microbiology 2024Quote: ... Constructs for chlamydial transformation were cloned using high-fidelity (HiFi) cloning system from New England BioLabs (NEB). Primers were designed using the NEBuilder online primer generation tool (https://nebuilderv1.neb.com) ...
-
bioRxiv - Microbiology 2024Quote: ... treated or not for one hour at 56°C with 0.4 mg/mL proteinase K (P8107S, New England Biolabs) and then heated or not for one hour at 85°C.
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were treated with exonuclease (NEB) and shrimp alkaline phosphatase (TaKaRa) ...
-
bioRxiv - Microbiology 2024Quote: ... or the Monarch® DNA Gel Extraction Kit (New England Biolabs). In a few cases ...
-
bioRxiv - Microbiology 2024Quote: ... or the OneTaq® Quick-Load® 2X Master Mix with Standard Buffer (New England Biolabs) with 2.5 µL cDNA in 25 µL reaction volume ...
-
bioRxiv - Microbiology 2024Quote: cDNA was synthesized from the total RNA samples using either the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA), following the standard protocol with Random Primer Mix ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then used as DNA template for PCR reactions using standard Taq DNA polymerase (NEB).
-
bioRxiv - Microbiology 2024Quote: The intermediate strain nAB008 was generated by transforming FA19 with a plasmid assembled using Gibson Assembly (New England Biolabs) containing 4 fragments ...
-
bioRxiv - Microbiology 2024Quote: The intermediate strain was generated by transforming nAB019 with a plasmid assembled using Gibson Assembly (New England Biolabs) containing 4 fragments ...
-
bioRxiv - Microbiology 2024Quote: DNA sequencing libraries were prepared from ChIP-seq and Input DNA samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 2 (NEB), 5 μL of O-glycosidase (40,000 U/μL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... A mixture of 600 ng/µL of Cas9 protein (NEB: M0386) and sgRNA complex was prepared at a 1:1 ratio and 1 nL of the mixture was injected into zebrafish embryos at the one-cell stage ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Reverse transcription (1 µg total RNA or 500 ng at lower concentrations) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560L), resulting in cDNA concentrations of 50 and 25 ng/µL ...
-
bioRxiv - Microbiology 2024Quote: ... cloned into the pre-assembled vector using the NEBridge® Golden Gate Assembly Kit (BsaI-HF® v2; NEB). A synonymous point mutation (A17973G ...
-
bioRxiv - Microbiology 2024Quote: ... the Q5 Site-Directed Mutagenesis Kit from NEB was used according to the protocol and mutagenesis primers were designed using NEBaseChanger.