Labshake search
Citations for New England Biolabs :
6901 - 6950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and 0.5 µL of Murine RNase Inhibitor (NEB M0314S) were incubated for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10 mM ATP (NEB P0756S), 1 µL of E ...
-
bioRxiv - Genomics 2024Quote: ... coli Poly(A) Polymerase (NEB M0276S) and 0.5 µL of Murine RNase Inhibitor (NEB M0314S ...
-
bioRxiv - Genomics 2024Quote: ... 8 µL of 5X Induro RT Buffer (NEB M0681S), 12.6 µL nuclease free water ...
-
bioRxiv - Genomics 2024Quote: ... 0.4 µL RNase Inhibitor and 2 µL Induro RT (200 U/µL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by a 4-hour linearization with XbaI endonuclease (NEB, Canada) at 37 °C ...
-
bioRxiv - Genetics 2024Quote: ... All restriction digest reactions were performed with enzymes provided by NEB according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEBα (NEB, Canada) competent cells and further recovered using GeneJET Plasmid Maxiprep Kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... and Exonuclease I (NEB M0293L) reactions were performed on-chip 50 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 ml of virus was incubated with 1 ml DNase I (NEB, 2 units/ml), 4 µL DNase I buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting product was digested using XcmI enzyme (New England Biolabs, Ipswich, MA) and run on a 2% agarose gel ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA pull-down was performed using the Magnetic Isolation Module (New England Biolabs). After construction ...
-
bioRxiv - Neuroscience 2024Quote: ... RNAseq libraries were constructed using a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). mRNA pull-down was performed using the Magnetic Isolation Module (New England Biolabs) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was then performed on all remaining RNAs (New England BioLabs, Cat. No. E7765S). Sequencing was performed at the Chan Zuckerberg Biohub and the UCSF Center for Advanced Techonlogy.
-
bioRxiv - Neuroscience 2024Quote: ... The library was prepared by first depleting ribosomal RNA (New England BioLabs, Cat No. E7405L). cDNA synthesis was then performed on all remaining RNAs (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... The pooled DNA was PCR-amplified using Phusion® High-Fidelity PCR Kit (NEB®), followed by purification with a Monarch® PCR & DNA Cleanup Kit (NEB®) ...
-
bioRxiv - Genomics 2024Quote: ... NEB buffer 3.1 (NEB) and 270 nM of HBG-sgRNA (Synthego) ...
-
bioRxiv - Immunology 2024Quote: ... recombinant human Furin (New England Biolabs Inc., Ipswich, MA, USA) was diluted in PBS and added to assays as indicated at a concentration of 10 U/ml ...
-
bioRxiv - Microbiology 2024Quote: ... restriction enzymes and T7 ligase (NEB Biolabs, USA) were used according to manual ...
-
bioRxiv - Immunology 2024Quote: ... vector were digested using AscI and SbfI (New England Biolabs) and ligated by T4 DNA ligase (Promega Corporation) ...
-
bioRxiv - Immunology 2024Quote: ... transcribed in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit (#E2040S, NEB) and purified with RNA Clean & Concentrator™ (#R1017 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of tailing mix (0.05 µl Terminal Transferase (NEB, cat. no. M0315), 0.1 µl 10x Cutsmart buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified heterotrimer was de-phosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM MnCl2) with 800 units Lambda phosphatase (New England Biolabs P0753S) in a final volume of 70μl and incubated at 30°C for 45min ...
-
bioRxiv - Biochemistry 2024Quote: ... truncated K227Q (New England Biolabs, M0351L). Residual linker was eliminated by 25 U 5’Deadenylase and 15 U RecJf for 60 min at 30°C ...
-
bioRxiv - Biochemistry 2024Quote: RP library construction in brief: Footprint RNA was dephosphorylated using 5 U of T4 PNK (New England Biolabs, M0201S). Subsequently ...
-
bioRxiv - Cancer Biology 2024Quote: ... EcoP15I (NEB) was used to cleave 27 nt downstream of the recognition site at the 5’ linker ...
-
bioRxiv - Cancer Biology 2024Quote: ... 25 µl NEBNext HiFi 2× PCR Master mix (NEB) was immediately added and mixed before proceeding to PCR cycles (58 °C for 5 min (gap filling) ...
-
bioRxiv - Cell Biology 2024Quote: Purified or crude viral supernatant was DNase I treated for 90 minutes at 37°C according to manufacturer’s instructions (New England BioLabs). qPCR was performed using a custom FAM probe against Nano Luciferase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and Dual Index Set (NEB) were used ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA was depleted using the bacteria rRNA depletion kit (New England Biolabs), with the addition of human rRNA depletion beads for the samples containing S ...
-
bioRxiv - Microbiology 2024Quote: ... or a region in the N-terminal part (for TGDs) were PCR amplified (see Table S4 for primer sequences) from 3D7 or IT4 gDNA (Monarch gDNA Purification Kit, NEB or QIAGEN DNA extraction kit) and cloned into pSLI (Birnbaum et al. ...
-
bioRxiv - Microbiology 2024Quote: ... employing the 2x Luna Universal master mix (NEB). For competitive assays ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA isolation from C20 cells was carried out as described above and total RNA was enriched in poly-A tailed RNA transcripts by double incubation with Oligo d(T) Magnetic Beads (NEB, S1419S) and fragmented for 9 minutes at 94°C in 2X Superscript III first-strand buffer containing 10 mM DTT (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently replaced with the tailed rpoS DNA fragment using the HiFi DNA assembly kit (NEB). Following the assembly reaction ...
-
bioRxiv - Immunology 2024Quote: ... The mCherry ORF was excised from pGW163 using NcoI and HindIII (NEB) and subsequently replaced with the tailed rpoS DNA fragment using the HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... the DNA was transformed into NEB® 5-alpha F’ I q chemically competent cells (NEB). Recombinants were selected on LB agar supplemented with 10 µg/ml of gentamicin ...
-
bioRxiv - Immunology 2024Quote: ... burgdorferi B31 [NCBI:txid224326] genomic DNA using Q5 DNA polymerase (NEB, Beverly, MA) and the b31_rpoS_gibson_F (5’-agaattcattaaagaggagaaattacccatgaacatatttagtaatgaggatttaaacat −3’ ...
-
bioRxiv - Immunology 2024Quote: ... Point mutations were added by Gibson (NEB) assembly of the large fragment and a small synthesized (Genewiz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40U DNaseI (NEB)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... reconstituted E.coli PURExpress ΔRF123 expression system (NEB) at 37° for 1hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 200 ng gDNA was used for enzymatic conversion (NEB E7125). A total of 18 CREs were selected for this study ...
-
bioRxiv - Molecular Biology 2024Quote: ... To ensure this we performed the Oligonucleotide Clean-up protocol of the Monarch PCR & DNA Clean-up kit (NEB) on 10 PCR reaction tubes ...
-
bioRxiv - Molecular Biology 2024Quote: ... as described by NEB and eluted with 400 µL of de-ionised water.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA from clinical samples (Table S2, S3) was PCR amplified using Taq DNA polymerase with ThermoPol®-Buffer (New England Biolabs). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NebNext® UltraTM II DNA library prep kit (NEB) for Illumina was used for sequencing library preparation following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and ligated into the BamHI (NEB) and EcoRI (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and EcoRI (NEB) digested sites of pCAG-EGxxFP ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: ... On the next day, 0.5 µL of calf intestinal alkaline phosphatase (CIP) (M0290, New England Biolabs (NEB)) was added and the reaction was incubated for 1 h at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... POINT-seq libraries were made with the NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB). POINT5-seq libraries were made with the SMARTer Stranded RNA-Seq kit (Takara Bio ...