Labshake search
Citations for New England Biolabs :
6651 - 6700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 1 hour at 25°C with 20% PEG8000 (New England Biolabs). After ligation ...
-
bioRxiv - Microbiology 2024Quote: ... Purified PCR products were cloned into the PmeI site of the pMSR0 vector using NEBuilder HiFi DNA Assembly (New England Biolabs). The resulting plasmid was transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... The HiFi Assembly reaction master mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was added to a column containing 2.5 mL amylose resin (NEB). The resin was washed with 50 mL of column buffer and proteins were eluted with 20 mL cold Column buffer containing 10mM maltose ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB) and checked on 1% agarose gel and approximately 600 ng of each PCR product was used as template for in vitro dsRNA synthesis according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Gaussia princeps luciferase (New England Biolabs, #E8023, 1:5,000), Histone H3 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were assembled using NEBuilder HiFi DNA assembly kit (NEB). DNA was quantified on a Nanodrop Lite or Qubit ...
-
bioRxiv - Microbiology 2024Quote: ... or Phusion DNA Polymerases (NEB). DNA was digested with restriction enzymes from NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA fragments was mixed with 10 μL of streptavidin-coated magnetic beads (NEB Catalog # S1421S) and 500 μL of binding buffer (5 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of terminal transferase (20 units, NEB Catalog #M0315S) was added to the reaction with incubation at 37 °C for 1 h to block any pre-existing strand-break sites ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was digested with restriction enzymes from NEB. PCR products were purified with DNA Spin and Concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... The fragments were then assembled using NEBuilder HiFi DNA assembly master mix (NEB) to place the cassette sequence positioned in the middle ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA was then purified using the Monarch PCR & DNA Cleanup Kit (NEB), and RNA was synthesised from the purified DNA using the MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Rpa2WH (Rpa2178-268) were cloned from the pRSFduet(+) constructs using the Q5 site directed mutagenesis kit (E0554, New England Biolabs).
-
bioRxiv - Molecular Biology 2024Quote: ... and T7 DNA ligase (3000U/µl) (New England Biolabs). The product was purified and transformed into EnduraTM DUOs Electrocompetent cells (LGC ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: ... Deglycosylation was performed with either PNGase F or EndoH (both from NEB), following the protocol of the manufacturer.
-
bioRxiv - Microbiology 2024Quote: ... 50 pmol RNA was dephosphorylated with 10 units of calf intestine alkaline phosphatase (#M0290, New England Biolabs) in a 50 μl reaction at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... dsRNA was purified using Monarch RNA Cleanup Kit (50 μg; NEB) and checked on 1% agarose gel and concentration measured with a NanoDrop One spectrophotometer (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA template for in vitro transcription were obtained by cDNA amplification using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) following manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... A customized linker (rand10_3Tr3) was added to the 3’ end of on-bead LAM products using T4 RNA ligase I (M0204S, NEB). Nested PCR was performed using indicated primer set (3Tr3-Adaptor_R and JM_F ...
-
bioRxiv - Neuroscience 2024Quote: The RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA from SH-SY5Y cells and iPSCs was extracted with the Monarch Genomic DNA Purification Kit (NEB). PCR was performed with Q5 Hot Start High-Fidelity Master Mix (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... or HiScribe T7 ARCA mRNA Kit (New England Biolabs), evaluated spectrophotometrically and by gel electrophoresis ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was clarified by centrifugation at 100,000 × g for 30 min and incubated with amylose affinity resin (New England BioLabs). Resin was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEB HiFi assembly kit (New England Biolabs) was used to clone the gene fragment into a pET29b expression vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs encoding BE3 or SsCBE2-C2 were linearized using the PmeI restriction enzyme (NEW ENGLAND BioLabs). mRNAs of base editors and gRNA were synthesized in vitro from linearized DNA templates using the mMESSAGE mMACHINE T7 Ultra kit (Ambion ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons were then cloned into the wild-type SsCBE-UGI-C2 vector using Gibson Assembly Master Mix (New England Biolabs). The cjSsCBE2 was constructed by exchanging APOBEC1 domain of cjCBEmax to SsdAtox-SRE domain ...
-
bioRxiv - Microbiology 2024Quote: ... DNA sequences were amplified and amended with ≥18 bp homology to their destination vectors using Q5 Hot Start High Fidelity Master Mix (NEB, M0494L). Vectors were constructed using Gibson Assembly with HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Lunascript (New England Biolabs). Transcripts were amplified with either random hexamer (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Vectors were constructed using Gibson Assembly with HiFi DNA Assembly Master Mix (NEB, E2621L) as described54,55 and transformed into OmniPir via heat shock or electroporation ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: ... 0.5 µL of calf intestinal alkaline phosphatase (CIP) (M0290, New England Biolabs (NEB)) was added and the reaction was incubated for 1 h at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... The mCherry gene was excised from pL1694 by BamHI and NotI and replaced by a human codon-optimised spCas9 from pUF1-Cas912 by Gibson cloning (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, NEB) to generate pL1694-GIMO-Cas9.
-
bioRxiv - Molecular Biology 2024Quote: ... A preheated mixture of 10 µl of RNase H (New England Biolabs) and 2 µl of RNase H Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pPbU6-hdhfr/yfcu plasmid and the synthetic fragment were digested with BsmBI and AatII (NEB) and ligated into the vector with T4 ligase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Molecular Biology 2024Quote: ... The mCherry gene was excised from pL1694 by BamHI and NotI and replaced by a human codon-optimised spCas9 from pUF1-Cas912 by Gibson cloning (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, NEB) to generate pL1694-GIMO-Cas9.
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.05% SDS) supplemented with 5.25 µl of 20lJmglJml−1 Proteinase K (NEB) and 1.25 µL of 1lJM DTT (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quantification was done using NEB Next® Library Quant Kit for Illumina® (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq libraries were built using an NEBNext® Ultra™ II DNA Library Prep Kit (NEB #E7645S/L) with immunoprecipitated or input DNA ...
-
bioRxiv - Microbiology 2024Quote: ... ligation-based library preparation was performed using a NEBNext Ultra II DNA Kit (NEB). The library was then subjected to Illumina NovaSeq paired-end sequencing (150-bp).
-
bioRxiv - Microbiology 2024Quote: ... TdT reaction buffer (1.5 µl), CoCl2 (5 µl, 0.25 mM) (NEB #B0252), and filtered H2O (4.5 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting amplicon was then used as a template in a PCR reaction (Q5, NEB) to add ends compatible with sequencing using custom primers (Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... and the viral genome fragments were ligated with T4 ligase (NEB). The purified ligation product was used as the template for in vitro transcription to produce full-length viral genome using mMESSAGE mMACHINE T7 Ultra Kit (Invitrogen).