Labshake search
Citations for New England Biolabs :
6451 - 6500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: All DNA constructs and oligos were designed using either Snapgene (BioMatters Ltd) or Primer3 (Koressaar and Remm 2007) and plasmids were assembled using isothermal HiFi assembly (New England Biolabs (NEB), Ipswitch ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were converted to sequencing libraries using the NEBNext Small RNA Library Prep kit for Illumina (New England Biolabs, E7300) using the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Commercially available NEB5- alpha chemically competent cells (NEB, Ipswich, MA) were used for routine transformations ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and ligating with T4 ligase (NEB M0202) for 16h ...
-
bioRxiv - Physiology 2024Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA) following the manufacturer’s instructions (New England Biolabs). Quantification and quality check of libraries was done using a Tapestation 4200 instrument and a D1000 ScreenTape (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with SfiI (NEB R0123) to remove its promoter and reporter sequence ...
-
bioRxiv - Synthetic Biology 2024Quote: RNA was extracted 48h after transfection using the Monarch total RNA miniprep kit (NEB T2010S) and stored at −80C until further processing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gibson Assembly MasterMix (New England Biolabs, Ipswich, MA, USA) was used for the creation of each vector as per the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: ... Phusion Hot Start Flex polymerase (New England Biolabs, M0535) was used according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Phusion Hot Start Flex polymerase (New England Biolabs, M0535) was used for the 1st round PCR ...
-
bioRxiv - Synthetic Biology 2024Quote: ... obtained from New England Biolabs (NEB), was employed throughout ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 uL of PEG 8000 (NEB), 1 mM of ATP ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was generated from 1 µg RNA using LunaScript RT SuperMix Kit (New England Biolabs). qPCR reactions were performed on an Applied Biosystems 7500 Real-Time PCR system using the Luna Universal qPCR MasterMix (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... enterocolitica cells grown as described above was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs). A 109 cells pellet was first washed in cold-resuspension buffer (1 ml of 10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2024Quote: ... primers TZ-54 and TZ-55 were used to amplify the C-terminus of CapRelSJ46 using Taq polymerase (NEB) and 0.5 mM MnCl2 was added to the reaction as the mutagenic agent ...
-
bioRxiv - Microbiology 2024Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... coli RNase H (New England Biolabs) was then used to initiate a sequence-specific rRNA cleavage in 10 µL final volume ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U of quick CIP (NEB), and water as needed ...
-
bioRxiv - Microbiology 2024Quote: ... All reactions were supplemented with 0.8 U/µL RNase Inhibitor Murine (NEB, M0314S). Purified His6-MBP-tagged CapRelSJ46 protein was added to the reaction at a final concentration of 500 nM ...
-
bioRxiv - Microbiology 2024Quote: ... Both genes were cloned separately into the pPink-HC expression vector multiple cloning site (MCS) using EcoRI and FseI (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2024Quote: ... Both genes were cloned separately into the pPink-HC expression vector multiple cloning site (MCS) using EcoRI and FseI (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR steps were carried out with Phusion polymerase (NEB) using the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2024Quote: ... The P1 expression plasmid was linearised by SacII (NEB), and the 3CD PCR product inserted ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting plasmid was linearised by AflII digestion (NEB) and transformed into PichiaPink™ Strain one (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 RNA ligase (M0204S, NEB), T4 RNA ligase 2 (M0239S ...
-
bioRxiv - Molecular Biology 2024Quote: gBlock DNA was digested out of the TOPO vectors using BstXI (New England Biolabs), sites which are present in the vector on either side of the insert and are absent from gBlocks ...
-
bioRxiv - Molecular Biology 2024Quote: 50 ng of DNA template was transcribed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol but at one-quarter volume (5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 27.5 µl and 12.5 µl of NEBNext Sample Purification Beads (New England Biolabs) were used in the first and second steps ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 50 µl PCR product with 10 µl of 6X Purple Loading Dye (New England Biolabs) was electrophoresed through a 50 ml gel – 1% SeaKem Agarose (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: DICER RNA substrates have been obtained using PCR synthetized linear DNA bearing T7 promoter and HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040S) following manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Length of DNA Fragments were determined by agarose gel electrophoresis and then purified with Monarch DNA Gel Extraction Kit (NEB # T1020L). DNA concentration has been assessed by Nanodrop.
-
bioRxiv - Molecular Biology 2024Quote: T7 in vitro transcribed (IVT) RNA (DS2_AS) was dephosphorylated with Quick CIP (NEB # M0525S) for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... ssDNA for DNA:RNA heteroduplex (400nt) has been prepared using phosphorylated primer and Lambda Exonuclease (NEB # M0262S). Length of DNA Fragments were determined by agarose gel electrophoresis and then purified with Monarch DNA Gel Extraction Kit (NEB # T1020L) ...
-
bioRxiv - Molecular Biology 2024Quote: 50-100 ng of purified PCR product was prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 10 µg Monarch RNA Cleanup Column (New England Biolabs) and eluted in 42 µl of nuclease-free water.
-
bioRxiv - Molecular Biology 2024Quote: 175-225 ng of purified PCR product was prepared for sequencing using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNased RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer ACAATTCGTCTTAAGGAATTTACCAATACACGCAA (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 50 µg Monarch RNA Cleanup Column (New England Biolabs), eluted in 20 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was purified using a 10 µg Monarch RNA Cleanup Column (New England Biolabs) and eluted in 10 µl of nuclease-free water.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was carried out on 200-300 ng of restricted genomic DNA using OneTaq 2X Master Mix (NEB) with primers complementary to sequences within the neo cassette that flanked the intron [Neotet1s ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µl of RNase H Buffer (New England Biolabs) was added and incubated at 45°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Alkylated RNA was purified with the Monarch RNA Cleanup Kit (New England Biolabs). RNA quality was confirmed after each purification with a TapeStation 4150 (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The digestion was stopped with ribonucleoside vanadyl complex (NEB, Cat. No. S1402S) at a final concentration of 20 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl Proteinase K (NEB, NEB, P8107S), 5 µl H2O (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified with the Monarch Total RNA Miniprep Kit (New England Biolabs). Alkylated RNA was purified with the Monarch RNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... primer O3P (Supplementary Table 3) was attached to IP-purified DNA and was extended by NEBNext Ultra II Q5 Master Mix (New England Biolabs), followed by ExoI (New England Biolabs ...