Labshake search
Citations for New England Biolabs :
5451 - 5500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was prepared using M-MuLV Reverse Transcriptase (New England Biolabs) and oligo(dT)20 primers using the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... and USER Enzyme (New England Biolabs), according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... magnetic beads at 25°C for 15 minutes and subsequently subjected to DNA-end repair with 0.5 U/µL T4 polynucleotide kinase (New England Biolabs, M0201), 0.12 U/µL T4 DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ribosomal RNA was depleted using the NEBNext rRNA Depletion Kit v2 (NEB; E7400L) and libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB; E7770L). Pooled libraries were sequenced on the NovaSeq 6000 instrument using paired-end 51 cycle reads.
-
bioRxiv - Molecular Biology 2024Quote: ... PCR adapters from Oxford Nanopore Technologies (ONT #SQK-PSK004) were ligated to end repaired DNA using NEB Blunt/TA Ligase Master Mix (NEB #M0367). 1x MeDIP master mix (10 mM Sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using Monarch RNA Cleanup Kit (NEB, T2030S). 100 ng mRNA was aliquoted and stored as input at –80°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was isolated using the mRNA Isolation kit (NEB, S1550S). mRNA was fragmented using the NEBNext Magnesium RNA fragmentation module (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified mRNA was treated with Antarctic Phosphatase (NEB, M0289) for 1h at 37°C followed by another purification round using MEGAclear ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 1.2 μM for FRAP and 0.06 μM (NEB) for FCS for 30 min and then washed cells in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Several components of the mRNA synthesis were used in combination in this reaction: ARCA (NEB, S1411), CleanCap Reagent AG (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... A self-packed XK column (Cytiva) with 15 mL of Amylose resin (New England Biolabs) was attached to the HisTrap column ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with SNAP TMR-STAR (NEB) at 1.2 μM for FRAP and 0.06 μM (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then we used ProtoScript® II First Strand cDNA Synthesis Kit (NEB) and 3′-RACE CDS primer (ClonTech ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.45% Tween-20) and Proteinase K (NEB, molecular biology grade) diluted tenfold in NEB storage buffer (20 mM Tris pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA enrichment was performed using the NEBNext Poly(A) Magnetic Isolation Module (NEB). RNA library preparation was conducted using the NEXTFlex Rapid Directional qRNA-Seq Kit (Bioo Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... underwent modification through Taq ligase (M0208L) and New England Biolabs (NEB) buffer (B0208S) ...
-
bioRxiv - Molecular Biology 2024Quote: pLV-CMV-SNAPtag-DasherGFP was transformed into NEB Stable Competent E.coli (New England Biolabs; Massachusetts, USA) and a single colony was inoculated at 30 °C in 200 mL Terrific Broth ...
-
bioRxiv - Molecular Biology 2024Quote: 10 µg of DNase-treated total RNA was digested with 5 U of RNase H (NEB) and 2 picomoles of a chimeric oligonucleotide targeting the MSRs for 20 minutes at 37 ℃ ...
-
bioRxiv - Molecular Biology 2024Quote: ... dsDNA templates were generated using T7 DNA Polymerase (New England Biolabs) and then subjected to an in vitro transcription reaction with T7 RNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then subjected to an in vitro transcription reaction with T7 RNA polymerase (New England Biolabs) at 37°C for 6 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Xrn1 (NEB) treatments were performed with 1 U of enzyme and incubation for 1 hr at 30 ℃ ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified PCR products were digested with NotI (New England Biolabs) and ligated into pMON721 linearized with NotI to generate the SEGS-1 G ...
-
bioRxiv - Molecular Biology 2024Quote: To quantify HBV cccDNA levels DNA isolated fraction from the infected cells was treated for 1h with T5 exonuclease86 (5U, New England Biolabs) and purified using a DNA clean and concentrator kit (Zymo research ...
-
bioRxiv - Molecular Biology 2024Quote: ... individual PCR amplicons were produced using Q5 high fidelity polymerase (NEB # M0491S) and isolated from a 0.5X TBE gel by centrifugation of a gel core through an EconoSpin column (Epoch Life Science ...
-
bioRxiv - Molecular Biology 2024Quote: ... including BsaI-HF-v2 (NEB #R3733S), Esp3I (NEB #R0734S) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Ligation of Unique Dual Index Barcodes or Unique Dual Index UMI Adaptors (NEB). Barcoding PCR was consistently carried out using only 5 PCR cycles with NEBNext High-Fidelity 2X PCR Mix and subsequent size selection using agarose gel or beads (Ampure XP) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two hundred µL of resuspension medium (SOC for DH5α and OneShot cells; NEB 10-beta stable outgrowth medium for 10-beta cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... was cloned downstream the tagBFP combining inverse PCR and blunt end ligation (T4 Ligase NEB). The sequence of circ-HDGFRP3 (exons 2-3-4-5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% glycerol) and one time with molecular grade water followed by incubation with proteinase K (New England Biolabs) at 55 °C for 30 minutes with constant shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... 300 pmol of Cas9 protein (NEB, Cat. No. M0386M) and 600 pmol of sgRNA were incubated in Cas9 Buffer (150 mM KCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl Proteinase K (NEB, NEB, P8107S), 5 µl H2O (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dephosphorylation reaction was supplemented with 0.5 μl T4 PNK (NEB, Cat. No. M0201S), and the reaction was incubated for 25 minutes ...
-
bioRxiv - Microbiology 2024Quote: Total RNA samples were treated with a NEBNext rRNA depletion kit (NEB) to remove rRNA ...
-
bioRxiv - Microbiology 2024Quote: ... followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs). 10 µg Capped mRNA transcripts were electroporated into BHK-21 cells in a 0.2 cm cuvette (25 μF ...
-
bioRxiv - Microbiology 2024Quote: ... The mCherry gene was cloned into the pLV plasmid using using NEBuilder® HiFi DNA Assembly (New England Biolabs), to generate the final pLV-mCherry product ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was produced using a ProtoScript® II Reverse Transcriptase (New England Biolabs) reaction and a Spike-specific reverse primer (5’ CTGAAGGAGTAGCATCCTTG 3’) ...
-
bioRxiv - Microbiology 2024Quote: ... Empty pCAGGS plasmid vector was digested using restriction enzymes KpnI-HF and SphI-HF (New England Biolabs) and purified using QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... remnant parent templates were digested using DpnI (New England Biolabs), and DNA products were gel purified using Zymo Gel DNA Recovery Kit (Zymogen) ...
-
bioRxiv - Microbiology 2024Quote: ... coli (New England Biolabs), which were plated and incubated at 37°C overnight on LB Agar Carbenicillin (100 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... These PCR products were inserted into EcoRI-XhoI-digested linearized pCAGGS using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Ipswich, MA, USA). Previously constructed plasmids expressing G of VSBV-1 ...
-
bioRxiv - Microbiology 2024Quote: ... backbone (containing Blasticidin resistance gene for the selection of transduced cells) and mCherry gene were PCR amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs), remnant parent templates were digested using DpnI (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... Spike DNA fragments were introduced into the digested pCAGGS vector using NEBuilder® HiFi DNA Assembly (New England Biolabs). The product of this assembly reaction was transformed into 5-alpha Competent E ...
-
bioRxiv - Microbiology 2024Quote: ... Unused primers were then degraded with Exonuclease I (NEB). The cDNA from different samples was then combined into pools ...
-
bioRxiv - Microbiology 2024Quote: ... All PCRs were performed using Q5 high-fidelity DNA polymerase (NEB). Plasmids with desired mutation were cloned in Escherichia coli DH5α ...
-
bioRxiv - Microbiology 2024Quote: ... was digested with XbaI and MluI restriction enzymes and barcoded linear HA libraries were inserted into the lentivirus backbone using NEB HiFi assembly kit (NEB E5520S). Assembled plasmid libraries were then electroporated into electrocompetent 10b cells (NEB C3020K ...
-
bioRxiv - Microbiology 2024Quote: ... Assembled plasmid libraries were then electroporated into electrocompetent 10b cells (NEB C3020K) and incubated overnight on ampicillin containing LB plates ...
-
bioRxiv - Microbiology 2024Quote: ... HiFi DNA assembly cloning kit (New England Biolabs (NEB)) was used according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... The HiFi Assembly reaction master mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2024Quote: ... The products of the HiFi reaction were transformed into NEB10β competent cells (NEB) and plated on LB agar with appropriate antibiotics ...