Labshake search
Citations for New England Biolabs :
5251 - 5300 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The template was gel-purified using Monarch PCR & DNA Cleanup Kit (New England Biolabs, Massachusettes, USA) and transformed into UKMCC1015 electrocompetent cells ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR replication of Geneblocks was conducted using Q5® Hot Start High-Fidelity Master Mix (NEB; as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Phage DNA was subjected to two rounds of PCR using Q5 High-Fidelity 2X Mastermix (NEB), as previously described (Garrett et al. ...
-
bioRxiv - Immunology 2023Quote: ... and 100-200ng were PCR amplified using Q5 Hot Start High Fidelity 2x Master Mix (NEB) and 10µM forward/reverse primers flanking the region of interest ...
-
bioRxiv - Genomics 2023Quote: ... The region containing the linker-mAID sequence was then amplified by PCR using Phusion polymerase (NEB) from the modified pMK287-mAID-Hygro plasmid and subcloned into the pL452 vector which harbors the Neomycin resistance cassette under the control of a PGK promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... In brief, DNA fragments were amplified by PCR (Q5 2x Master Mix, New England Biolabs (NEB)) ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulted PCR product co-transformed with pEGFP-C1-2µ-URA3 cut with BamHI (NEB, R3136) into yeast strain BY4743 (EUROSCARF Y20000 ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo plasmid was linearized via Polymerase Chain Reaction (PCR) with the Q5 DNA polymerase (NEB) and a pair of primers for each Cac1 mutant that anneal to the sequences flanking the section to be modified (Supplementary Table 2) ...
-
bioRxiv - Cell Biology 2023Quote: ... HindIII/NotI-digested PCR reactant and backbone were ligated by T4 DNA ligase (New England Biolabs) and transformed to CloneCatcher™ (Genlantis ...
-
bioRxiv - Genetics 2023Quote: ... PCR was performed on genomic DNA by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) followed by T7 endonuclease I assay (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... 10 μl of PCR product was incubated with 0.5 μl of T7e1 enzyme (New England Biolabs) for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA purification was performed with the Monarch PCR & DNA Cleanup kit (New England Biolabs, Ipswich, MA), or the DNA Clean & Concentrator Kit (Zymo Research) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplification of purified DNA was done using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The integrity of the purified raspberry DNA was demonstrated by amplification of a 325nt portion of the EIF 2.1 gene using primers 1468(F ...
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified PCR product and pET28a plasmid were incubated with NheI and BamHI restriction enzymes (NEB) following the manufacturer’s protocol for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... and SDS samples were concentrated using the Monarch PCR & DNA Cleanup Kit (NEB, South Hamilton, MA). Samples were resolved on a 1% agarose TAE gel with ethidium bromide and imaged using BioRad ChemiDoc MP Imaging system (Hercules ...
-
bioRxiv - Cancer Biology 2023Quote: ... Standard cloning was performed using PCR (35 μL ddH2O, 10 μL 5x HF Phusion buffer (NEB), 1 μL of 10 mM mixed dNTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted transposed DNA was submitted to PCR using Q5 High-Fidelity Polymerase (New England Biolabs). DNA was amplified with 7 cycles of PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genetics 2023Quote: ... All PCR amplifications were done using Q5® High-Fidelity DNA Polymerase (New England Biolabs, UK) following manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and library amplification was performed using NEBNext® High-Fidelity 2X PCR Master Mix (M0541L-NEB) with Nextera Ad1_noMX and Ad2.X primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... pDEST17 was linearized by high fidelity PCR (Q5 High-Fidelity 2x Master Mix, NEB, Cat #M0492), during which sequence encoding the 6x His tag was removed ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... the PCR product was used for restriction digest with AvaI (New England BioLabs, Cat. No. R0152L) to identify the presence of the mutation ...
-
bioRxiv - Synthetic Biology 2023Quote: All PCR reactions used for plasmid assembly were done using the 2x Phusion mix from NEB, in a 50 µL volume ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 μl of PCR product was incubated with 0.5 μl of T7e1 enzyme (New England Biolabs) for 30 minutes at 37◦C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library was PCR amplified for 5 cycles using the NEBNext High-Fidelity MasterMix (New England BioLabs) followed by qPCR amplification to determine the exact number of additional cycles required for optimal library amplification ...
-
bioRxiv - Biochemistry 2023Quote: DNA templates for the transformation assays were prepared by PCR amplification from the pUC19 plasmid (NEB), after which the PCR fragments were Dpn1-treated ...
-
bioRxiv - Biochemistry 2023Quote: All plasmids were generated by using some combination of PCR amplification using Q5 DNA polymerase (NEB), HiFi Assembly (NEB ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 μL 25μM P5 adapter and 25 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). Transposed DNA was amplified for 5 min at 72°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genomics 2022Quote: ... oligo pools were PCR amplified in multiple reactions with low cycle number (NEB Ultra II MM), digested ...
-
bioRxiv - Biochemistry 2023Quote: ... the following was mixed: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 μL 10 μM i5 indexing adapter ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library PCR amplification was performed with 10uL of 2x Phusion HiFi master mix (New England Biolabs), 8uL of cDNA sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... va mtSSB ΔMTS by PCR amplification and ligation (Q5 Site-Directed Mutagenesis Kit, NEB, Cat #E0554). The plasmid insert was sequence-verified and then transformed into E ...
-
bioRxiv - Biochemistry 2023Quote: The PCR product was purified and 1 µg was phosphorylated using 10 units T4 PNK (NEB) in 20 µl of T4 ligase buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmid pJC1-trpE (7749 bp) was amplified by PCR using oligonucleotides with degenerated (NNK) codons (NEB Q5 Site-Directed-Mutagenesis Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed on genomic DNA by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) followed by T7 endonuclease I assay (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR products were used as templates for transcription reactions using T3 RNA polymerase (Biolabs, M0378S) or T7 RNA polymerase (TOYOBO ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were then isolated via gel electrophoresis and assembled using HiFi assembly mix (NEB #E2621L). Plasmids were verified by DNA sequencing and stored at -20°C until use in NanoBRET assays.
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: ... The effector AVR-Pii from was obtained via PCR amplification using Phusion Polymerase (New England Biolabs). Primers were designed on the promoter and terminator of ZiF_VIIIc from BTJP 4-1 and included the overhangs required for plasmid assembly ...
-
bioRxiv - Immunology 2023Quote: ... All cloning PCR amplifications were performed using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to standard procedures ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified for 12 cycles using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) in total volume of 25µl in the presence of 800nM of barcoded primers (400nM each ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was digested with enzymes NcoI and HindIII (New England Biolabs, Ipswich, Massachusetts, USA), ligated back into the pOPINB vector with T4 DNA ligase (New England Biolabs) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Genes were amplified by PCR from a testis cDNA library and digested by EcoR I (NEB) and Nde I (NEB) ...