Labshake search
Citations for New England Biolabs :
5151 - 5200 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 5 µg of the PCR product was subjected to Fragmentase® treatment (New England Biolab, NEB) until a smear of fragments was detected around 400-500pb by agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... The polymerase chain reaction (PCR) included 1-unit Phusion High-Fidelity DNA Polymerase (New England Biolabs), 1x Phusion buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were carried out in quadruplicate using Q5 High-Fidelity DNA Polymerase (NEB, Ipswich, MA). Each PCR reaction contains 0.5 uM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... 1μl was used for the Phusion High-Fidelity DNA Polymerase PCR reaction (New England Biolabs, USA) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Cryptic and alternatively spliced exons were PCR-amplified from the resulting cDNA with Q5 polymerase (NEB) and either Nup188 or POLDIP3 primers (IDT) ...
-
bioRxiv - Biophysics 2019Quote: ... of digested PCR generated DNA (P3_S1, P3_S2, P3_S2* and P3_S1S2) in 100 µl 1x T4 ligase buffer (NEB). Upon complete ligation of digested DNA ...
-
bioRxiv - Genetics 2019Quote: ... The PCR products were digested using the SfcI restriction enzyme (R0561S, New England Biolabs, Ipswich, MA). Differential band patterns signified successfully edited strains because the N2 S78C ...
-
bioRxiv - Genomics 2021Quote: ... All PCR amplifications were performed using a high-fidelity polymerase (Q5 DNA polymerase, New England Biolabs) to avoid PCR introduced sequence error.
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... using 12.5 µL of Phusion® High-Fidelity PCR Master Mix NEB (New England Biolabs Inc.), and 2 µl of Illumina forward and reverse [10 µM] primers ™ ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification reactions were performed using Phusion® High-Fidelity PCR Master Mix (New England Biolabs). Sanger sequencing (Genewiz ...
-
bioRxiv - Genomics 2021Quote: ... Each well contained 50 µL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs), 0.5 µL of each primer at 100 µM ...
-
bioRxiv - Developmental Biology 2021Quote: ... The EnVT15159 PCR product was then digested using HindIII and AgeI high fidelity restriction enzymes (NEB) in Cutsmart buffer (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... semi-quantitative PCR with 30 ng cDNA was performed using LongAmp® Taq DNA Polymerase (NEB) with primers in flanking exons detecting both isoforms MALT1A (146 bp ...
-
bioRxiv - Genomics 2021Quote: ... Beads were resuspended in 50 μL PCR master mix (25 μL 2X Phusion HF buffer (NEB), 1 μL 12.5 μM Nextera Ad1 primer (Illumina) ...
-
bioRxiv - Biochemistry 2021Quote: All PCR amplification steps described here were performed using the Phusion High-Fidelity DNA Polymerase (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... The transposed DNA was converted into libraries using NEBNext High Fidelity 2x PCR Master Mix (NEB) and the Nextera Index Kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR reactions were conducted using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, M0494L). Ligations were conducted using isothermal assembly with NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for the inverse PCR was digested with EcoRI-HF (R3101S, NEB, Ipswich, MA, USA). Digested genomic DNA was purified with GeneJET PCR Purification Kit (K0702 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Gas1 were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and cloned using CloneJET PCR Cloning Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified the ORF genes by PCR and cloned them using the Gibson Assembly protocol (NEB). For the CD95 (303-319 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coding sequences were PCR amplified from cDNA or vectors with Q5 high-fidelity Taq Polymerase (NEB) using the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids were generated by Gibson assembly of PCR fragments using the NEBuilder HiFi Master Mix (NEB). Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were purified using the Monarch PCR & DNA Cleanup Kit (New England BioLabs., Ipswich, MA, USA). Linearized plasmids ...
-
bioRxiv - Bioengineering 2021Quote: ... Loci to be sequenced were amplified by PCR with the Q5 DNA polymerase (New England Biolabs) according to the manufacturer’s instructions and sequenced at Microsynth AG.
-
bioRxiv - Genomics 2021Quote: ... The PCR reactions were cleaned up using 0.9X NEBNext Sample purification beads (E7137AA, New England Biolabs) and eluted in 25μL of 0.1X TE ...
-
bioRxiv - Genomics 2020Quote: ... All the PCR reactions were pooled together and treated with 200 U of Exonuclease I (NEB) per ml of PCR reaction for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: 16S ribosomal DNA templates (∼1,465 bp) were amplified using Q5 high fidelity PCR (New England Biolabs) with the universal primer set 27F (5’-AGAGTTTGATCCTGGCTCAG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were generated using the Q5 High-Fidelity DNA Polymerase (New England BioLabs, United Kingdom) with 50 ng genomic DNA as template ...
-
bioRxiv - Molecular Biology 2020Quote: All fragments were generated with PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493) and gel purified using the QIAquick Gel Extraction Kit (Qiagen 28704 ...
-
bioRxiv - Immunology 2020Quote: ... One microgram (1ug) of PCR was digested with 1ul of EcoR I-HF (New England Biolabs) and 1ul Hind III-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... DNA isolation from reaction mixtures was performed using Monarch PCR & DNA Clean-up Kit (NEB, USA). Plasmid miniprep DNA isolation was performed using Wizard Plus SV Minipreps DNA Purification System (Promega ...
-
bioRxiv - Genomics 2021Quote: ... and the purified DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Genomics 2021Quote: ... previously purified ATAC-DNA was amplified using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) with 10 cycles of PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... The digested PCR products and CIP-treated vectors were ligated with T4 DNA ligase (M0202, NEB) at 16°C on a PCR machine overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Typically, pL0s were generated via PCR (Q5 and OneTaq hot-start polymerases, New England BioLabs (NEB)) followed by In-Fusion (Takara Bio ...
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... DNA fragments were enriched by PCR using NEB Next Ultra II Q5 Master Mix (NEB M0544S), before final clean up using Sera-Mag beads ...
-
bioRxiv - Microbiology 2020Quote: ... The wild-type Chlamydia trachomatis ct276 gene was amplified by PCR with Phusion DNA polymerase (NEB) using 100 ng C ...
-
bioRxiv - Microbiology 2022Quote: ... This PCR product was assembled with EcoRV linearized pLJM1entr using HiFi DNA Assembly (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions targeting the 3CLpro gene were performed using Q5® High-Fidelity DNA Polymerase (NEB) and the resulting PCR products were mixed and matched to recombine SARSCoV-2 3CLproL50F ...
-
bioRxiv - Neuroscience 2022Quote: DNA was purified using the Monarch PCR and DNA cleanup kit (New England Biolabs, 13-0041) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed according the to the manufacturer’s protocol using Phusion DNA Polymerase (New England Biolabs). DNA fragments were purified using the GeneJET Gel Extraction Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The various msrDL mutants were cloned via quickchange mutagenesis by amplifying pMMB-msrDL-msrD(1-3):yfp with primers 36 to 51 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragment being then re-circularized via NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Recoded sequence without the 7A codon (ATGTACCTGATCTTCATGTAA ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then amplified using NEBNext High Fidelity PCR Master Mix (M0541S, New England Biolabs Inc.) and barcoded primers (see table MMX) ...
-
bioRxiv - Genomics 2022Quote: ... The assembled product was purified with the Monarch PCR&DNA Cleanup kit (New England BioLabs T1030L) and eluted in 12 μl of H2O.
-
bioRxiv - Cancer Biology 2022Quote: ... 200 ng of the purified PCR product was digested with T7 endonuclease I (New England BioLabs) as specified by the manufacturer ...