Labshake search
Citations for New England Biolabs :
5451 - 5500 of 7434 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was PCR amplified with Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Genetics 2020Quote: ... and the FRR1 gene was PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB, Ipswich MA, USA). PCR products were subjected to gel electrophoresis ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng A-tailed gel-isolated PCR product and 1 µl T4 DNA ligase (New England Biolabs) were mixed in a total reaction volume of 10 µl and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... The reaction was purified using a PCR clean-up kit according to manufacturer’s directions (NEB, Cat#: T1030S) or using ExoSAP-IT ...
-
bioRxiv - Neuroscience 2019Quote: ... A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 minutes and processed on an AATI fragment analyzer.
-
bioRxiv - Developmental Biology 2020Quote: ... 3’UTRs were PCR amplified and cloned into the NheI site of pMTNCSU7 using Gibson cloning (NEB) to create pDMP45 (Pmex-5∷mNeonGreen∷nos-2 3’UTR) ...
-
bioRxiv - Microbiology 2019Quote: ... Regular PCR analysis was performed using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) and detected by the T100™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Physiology 2019Quote: ... PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Guide RNAs were generated by PCR and transcribed using HiScribe T7 High-Yield RNA Synthesis Kit (NEB). 110-140 pg of guide RNA and 170 pg of cas9 mRNA per embryo was injected at one-cell stage into the cell ...
-
bioRxiv - Plant Biology 2019Quote: ... All cloning PCR reactions were performed with either Q5® High-Fidelity DNA Polymerase (New England Biolabs) or iProofTM High-Fidelity DNA Polymerase (BioRad Laboratories) ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Immunology 2019Quote: ... The pET28b plasmid and the PCR amplified target sequences were double digested using SalI-HF (NEB, # R3138S) and XbaI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The PCR fragments were recombined to the vector in 50 parallel NEBuilder HiFi DNA assembly reactions (NEB) according to the manufacturer’s instructions using 150 ng of linearized vector and 50 ng of custom CpG-free adapter-ligated genomic DNA ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was carried out by conventional PCR using crude DNA lysates and Taq polymerase (New England Biolabs). PCR products destined for cloning were made with Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Genetics 2020Quote: ... PCR genotyping was performed on extracted DNA in a total volume of 25 μl (12.5 μl NEB Q5 High-Fidelity Master Mix ...
-
bioRxiv - Genetics 2020Quote: The SaCas9-KKH gene was amplified by PCR using Q5 polymerase (New England Biolabs, Ipswich, MA, USA) and inserted into the pET28a plasmid between the EcoRI and XhoI restriction sites using 2X HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Microbiology 2020Quote: ... Specific gRNA and KOD PCR were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) on the pSAG1::Cas9-U6::sgUPRT vector (42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The 2099bp region (EnVT15159) was PCR amplified from purified yw67 gDNA using Q5 DNA polymerase MasterMix (NEB) and the following primers:
-
bioRxiv - Pathology 2021Quote: ... These clones were further analyzed by genomic PCR using Long Amp Taq DNA polymerase (New England Biolabs) to check the downstream inserted sequence ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Immunology 2020Quote: ... PCR-product and linearized vector were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identify >99.5% was given ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR fragment and the plasmid (pOPINS3C) were assembled using the NEBuilder HiFi DNA Assembly kit (NEB), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... which were PCR-amplified and ligated using exonuclease-based Gibson-assembly (Gibson Assembly Mastermix, New England Biolabs). Expression plasmids pcDNA4-mmPlxdc1-myc (macaca mulatta ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified by PCR using a Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). The 4-nucleotide overhangs and the BsaI target sites at 5’ strands at both borders were added by including these sequences in the primers ...
-
bioRxiv - Physiology 2021Quote: PCR amplification of DNA from plasmids or fly genomic DNA was done using Phusion polymerase (NEB – M0530). Digestion of plasmids with restriction enzymes was done at 37 °C for 2-3 hours ...
-
bioRxiv - Developmental Biology 2021Quote: The robo2robo2 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs #E2611). The four fragments were derived from pBluescript (plasmid backbone) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were used as template for in vitro transcription via T7 polymerase (New England BioLabs (NEB)) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were used as template for in vitro transcription via T7 polymerase (New England BioLabs (NEB)) ...
-
bioRxiv - Immunology 2021Quote: The pcDNA3.1-hCD4-tGFP-P2A-mCherry construct was cloned by assembly of PCR fragments (New England BioLabs) from the pcDNA3.1 expression vector (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR and assembled by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S).
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Genomics 2021Quote: ... 25 ul PCR reactions were prepared with LongAmp Taq 2x Master Mix (New England Biolabs, Inc; M0287L) and 0.4 uM of each primer ...
-
bioRxiv - Genomics 2021Quote: ... PCR reaction according to the manufacturer’s protocol (annealing temperature: 60°C; elongation time: 15sec, 19 cycles) (NEB). Of this reaction ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were enriched by PCR using Q5 High-Fidelity 2X Master Mix (New England Biolabs, #M0492S) and sequenced by the Illumina NextSeq 500 system in the Genomics Facility Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP tag was firstly PCR amplified from pSNAPf Vector (Cat. #N9183S, New England Biolabs, Ipswich, MA, USA) using primers 5’-CGT ACG ATC GAA TTC CCC ATG GAC AAA GAC TGC GAA ATG AAG CGC ACC ACC-3’ (forward ...
-
bioRxiv - Genetics 2020Quote: ... Each well contained 50 μL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs, M0541), 0.5 μL of each primer at 100 μM ...
-
bioRxiv - Cell Biology 2020Quote: The Mage-b10 locus was amplified by PCR and then amplicons were digested with BslI enzyme (NEB) at 55°C for 1 hour in NEB Cutsmart buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... oligos were annealed and extended with Bottom strand ultramer_2 using Phusion High-Fidelity PCR Mastermix (NEB, M0531) with Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The two PCR fragments were then assembled using the HiFi Gibson Assembly kit from NEB (Waltham, MA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR products corresponding to the correct size were excised and purified using DNA Gel Extraction kit (NEB). 100 ng of each gel-purified PCR products (total of 19 ...
-
bioRxiv - Biochemistry 2022Quote: The amplicons described above were purified with the Monarch PCR and DNA purification kit (New England Biolabs) and sent for NGS EZ Amplicon Sequencing by Genewiz ...
-
bioRxiv - Cell Biology 2022Quote: ... the wild-type and OGG1 (G245A) coding sequences were amplified by PCR with Phusion DNA polymerase (NEB) (primers indicated in Table S2 ...
-
bioRxiv - Genomics 2022Quote: ... and the PCR products were analyzed in 1% agarose with 1 kb DNA Ladder (New England Biolabs). Primers used in this study are shown in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... LRR-RLPs with no introns were PCR amplified from genomic DNA (Q5 Hot Start High-Fidelity, NEB), all others (Phvul.007g246600 and Vigun07g039700 ...
-
bioRxiv - Microbiology 2022Quote: ... Genes were PCR-amplified and inserted by ligation or NEBuilder HiFi DNA Assembly (New England Biolabs, E2621) or transferred from another plasmid by restriction digest and ligation ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... colony PCRs were performed using the commercial OneTaq™ master mix (New England BioLabs; Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR primed with pJ327-pJ328 was performed using Phusion High Fidelity DNA Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol on an Applied Biosystems 2720 Thermal Cycler ...