Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... RRID:Addgene_119754).CAPS-GST protein was expressed in BL21Star bacteria (NEB); the protein was isolated by binding to glutathione-Sepharose (Pierce ...
-
bioRxiv - Plant Biology 2024Quote: ... 2,5 μg total RNA was DNase treated according to manufacturer’s instructions (NEB, M0303, www.neb.com), precipitated in ethanol ...
-
bioRxiv - Plant Biology 2024Quote: ... The presence of mutation was identified by T7 Endonuclease digestion (NEB M0302, www.neb.com). Homozygous lines were obtained for further study ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCRs were done using qPCR Master Mix (NEB, M3003, www.neb.com) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the manufacturer’s instructions (NEB, E6300, www.neb.com). qPCRs were done using qPCR Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Phusion® HF DNA polymerase (NEB, USA) was used for all amplification steps ...
-
bioRxiv - Plant Biology 2024Quote: ... The pJET_ZEP3-NosT plasmid was digested with AvrII and SbfI restriction enzymes (NEB). These were then ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Linearization of the homology donor and pKS diaCas9_sgRNA plasmids were performed by KpnI-HF® and NdeI (NEB) restriction enzymes respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... and GFP-HSPTerminator amplicon from pMod_C3003 vector were amplified by PCR and assembled by using NEB HiFi assembly master mix (E2621S, NEB, USA). Later ...
-
bioRxiv - Plant Biology 2024Quote: ... 240 μl of oligo(dT) bead slurry (New England Biolabs, Frankfurt, Germany) were washed three times in 1 mL of lysis buffer (20 mM Tris-HCl pH 7.5 ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, #E7103) according to the manufacturer’s instructions ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... RNA library preparation was performed using the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB #E7775) or the SMRTbell Prep Kit 3.0 for Illumina and Iso-Seq respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Site-directed mutagenesis was performed using Q5 High Fidelity DNA Polymerase (New England Biolabs). The NanoLuc expressing plasmid was provided by PhoreMost Ltd (Cambridge ...
-
bioRxiv - Cell Biology 2024Quote: Homo sapiens cDNAs were amplified by PCR using Q5 High Fidelity DNA Polymerase (New England Biolabs) and sub-cloned into a variety of vector backbones as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2024Quote: ... and EcoR1 (New England Biolabs, Frankfurt a.M., Germany) restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated in 5 mL of a clearing solution comprising Clearing Premix (Vizgen, PN 20300003) and 50 μL Proteinase K (New England BioLabs) at 37°C in a humidified benchtop incubator until the tissue was cleared.
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Neuroscience 2024Quote: ... and then washed with 0.1x SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L) (NEB, M0314L). RNA released from the permeabilized tissue and captured by the DNB was reverse transcribed overnight at 42°C using SuperScript II (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated at 37°C for 5 minutes, and then washed with 0.1x SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L) (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... using BamH1 (New England Biolabs, Frankfurt a.M., Germany) and EcoR1 (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... the HpaI or ApaLI (New England Biolabs) linearized pENTR of attL1-UBIpro::GFP/AtRACK1a/NtRACK1-PafA::terHSP-attL2 and attL1-UBIpro/CC1pro::PafA-CC1::terHSP-attL2 were integrated into pMDC32_35S::FLAG-Pup(E)::ter3A::attR1-attR2::terNOS respectively through LR reactions.
-
bioRxiv - Plant Biology 2024Quote: ... Backbones and fragments were assembled with NEBuilder® HiFi DNA assembly mix (New England Biolabs) / In-fusion Master mix (Takara ...
-
bioRxiv - Plant Biology 2024Quote: ... F4 was first dephosphorylated by incubating with calf intestinal phosphatase (NEB) for 2 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The filtered lysate was passed over a gravity-flow column packed with 0.5 ml amylose resin (New England Biolabs) that had been pre-equilibrated with extraction buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... using a NEBNext® single cell/low input cDNA synthesis and amplification kit (E6421L) which uses a template switching method to generate full length cDNAs (New England BioLabs, Ipswich, MA, USA). IsoSeq libraries were prepared from the cDNA according to standard protocols using the SMRTbell v3.0 library prep kit (Menlo Park ...
-
bioRxiv - Plant Biology 2024Quote: ... dephosphorylated F4 (5 µM) was incubated with γ-[32P]-ATP and T4 polynucleotide kinase (NEB) for 45 min at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The Z. tritici codon-optimized GFP was amplified from pCeGFP (Kilaru et al. 2015) using NEB Phusion polymerase (New England Biolabs) and the primers listed in Supporting Information Supplementary Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: Deglycosylation of total brain homogenates was performed according to the PNGase F kit instruction manual (#P0704S, New England Biolabs). 40µg of protein were digested with 1,000 U of PNGase F enzyme.
-
bioRxiv - Synthetic Biology 2024Quote: ... The DNA concentration was determined using NEBnext library quant kit (NEB) and capillary electrophoresis (Bioanalyzer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Variants were transformed into BL21(DE3) cells (NEB), a single clone was picked and grown to saturation in LB media supplemented with kanamycin (50 µg/ml ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Restriction digest with AclI (NEB) and Bsu36I (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The product was subjected to DpnI digest (NEB) overnight and purified using SPRIselect beads (Beckman coulter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Upon preparation of the PCR mix (NEBNext Q5 mix, NEB) following the instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The NEBuilder HiFi DNA Assembly kit (NEB) was used to create the plasmid EPG-IRES-GCaMP6m ...
-
bioRxiv - Plant Biology 2024Quote: ... Using NEBNext Ultra II kits for Illumina (New England BioLabs, Ipswich, MA), each pool was indexed with a unique NEBNext i7 adapter and an i5 adapter containing a degenerate barcode (for removal of PCR duplicates ...
-
bioRxiv - Plant Biology 2024Quote: ... The beads were then boiled in SDS-loading buffer for subsequent western blotting using MBP antibodies (NEB, E8032S). Histone peptides utilized in this study were synthesized by EpiCypher and included H3 (1–32 aa) ...
-
bioRxiv - Plant Biology 2024Quote: ... The NEBNext Ultra RNA Library Prep Kit (NEB, USA, Cat. #E7530L) was used according to the manufacturer’s recommendations and index codes were incorporated into the libraries to attribute sequences to their respective samples ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR using Q5 High-Fidelity DNA polymerase (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from agar plate-grown seedlings by acid guanidinium thiocyanate-phenol-chloroform-based extraction and purified from the aqueous phase using the Monarch RNA Clean Up Kit (New England Biolabs, Ipswich, MA, USA; NEB). Genomic DNA in the samples was removed using TURBO™ DNase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from agar plate-grown seedlings by acid guanidinium thiocyanate-phenol-chloroform-based extraction and purified from the aqueous phase using the Monarch RNA Clean Up Kit (New England Biolabs, Ipswich, MA, USA; NEB). Genomic DNA in the samples was removed using TURBO™ DNase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... each genomic segment was amplified as two PCR products and cloned in the pDIVA backbone (Wetzel et al., 2018) using the NEBuilder HiFi DNA Assembly kit (NEB). The CP-RT ORF (without viral UTRs ...
-
bioRxiv - Neuroscience 2024Quote: ... An imaging activation mix was prepared by adding RNAse inhibitor (100 μL, New England BioLabs) to 250 μL Imaging Buffer Activator (VIZGEN ...
-
bioRxiv - Plant Biology 2024Quote: ... 75 roots were ground to a powder using a cooled pestle and mortar and homogenized in 20 ml Nuclei Extraction buffer (NEB) (20 mM MOPS (pH 7) ...
-
bioRxiv - Plant Biology 2024Quote: ... All clones were propagated in NEB10β Competent cells (NEB C3019I), and confirmed via Sanger (Eurofins Genomics ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Immunology 2024Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB, Ipswich, MA, USA). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR amplification was done using Phusion® High Fidelity DNA Polymerase (NEB) with an annealing temperature of 60°C and an extension time of 30 seconds ...
-
bioRxiv - Plant Biology 2024Quote: ... and the NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Cat. No. E7335S). Size selection was aimed at 300-400 bp fragments ...
-
bioRxiv - Pathology 2024Quote: ... NEB Next Poly(A) mRNA Magnetic Isolation Module (NEB) kit was used to enrich the poly(A ...