Labshake search
Citations for Illumina :
251 - 300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... and sequenced as paired-end 150 bp reads on a NextSeq 2000 (Illumina) using a P1 sequencing kit ...
-
bioRxiv - Plant Biology 2024Quote: ... The final pool was run at 750 pM with 2% PhiX control library on a NextSeq 2000 (Illumina) with a P3 300 cycle kit ...
-
bioRxiv - Plant Biology 2024Quote: ... prior to generating individual indexed libraries each from 1 μg RNA using the Stranded mRNA Prep kit (Illumina), as recommended ...
-
bioRxiv - Plant Biology 2024Quote: ... Using TruSeq stranded mRNA kit (Illumina), the fragmented mRNA was reverse transcribed to create the first strand of cDNA with random hexamers and SuperScript™ II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... with random hexamer primers (Illumina). Then the synthesized cDNA was subjected to end-repair ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA-seq library was prepared following TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA) using 1μg of total RNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Berkeley’s QB3 Genomics for Illumina MiSeq v3 300bp paired-end sequencing (Berkeley, CA, RRID:SCR_022170; Illumina, San Diego, CA, USA).
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were sequenced (single-end, 75 nt) using a NextSeq 500 platform (Illumina).
-
bioRxiv - Plant Biology 2024Quote: ... Amplification of purified cDNAs (two rounds of PCR to attach Illumina adapters and amplify the libraries) followed by AMPure XP cleanup (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... The Novaseq 6000 (Illumina, Inc, California, USA) was used for cluster generation and sequencing according to standard protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The TruSeq Stranded mRNA (Illumina, Inc, California, USA) was used in the succeeding steps ...
-
bioRxiv - Physiology 2024Quote: ... Resulting libraries showed a fragment size distribution of around 350 bp and were sequenced on a HiSeq 4000 (Illumina, USA) with 50bp single-end reads ...
-
bioRxiv - Physiology 2024Quote: ... and between 187 and 500 ng per sample were used as input for the TruSeq stranded mRNA library kit (Illumina, USA) following the manufacturers manual ...
-
bioRxiv - Plant Biology 2024Quote: ... Illumina cBOT (Illumina) was used for cluster generation ...
-
bioRxiv - Physiology 2024Quote: ... which was constructed on the HiSeq2000 (Illumina) platform with HDMI32-DraI ...
-
bioRxiv - Plant Biology 2024Quote: ... Purified cDNA was end-repaired on Illumina HiSeq X Ten sequencer (Illumina, San Diego, USA), adenylated and ligated to Illumina adapters as per NEBNext® Ultra™ II ...
-
bioRxiv - Plant Biology 2024Quote: ... The libraries were subsequently sequenced on an Illumina NextSeq 500 platform (Illumina, Inc.).
-
bioRxiv - Plant Biology 2024Quote: ... The library was constructed using Nextera XT Library Prep Kit (Illumina, USA) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2024Quote: ... RNA sequencing was performed using the NextSeq MID150 sequencing kit (20024904; Illumina) on the NextSeq500 sequencer (Ilumina ...
-
bioRxiv - Plant Biology 2024Quote: ... the RNA was processed with the NEBNext Ultra II RNA Library Prep Kit from Illumina (NEB; E7770L). The libraries were then sequenced on an Illumina NextSeq1000 system and analyzed on the Galaxy platform (59) ...
-
bioRxiv - Immunology 2024Quote: ... Beads were resuspended in 29 µL pre-warmed tagmentation buffer with 1 µL Tn5 transpose (Illumina, 20034197). Samples were incubated for 5 minutes with vigorous mixing at 1100 rpm at 37°C in a thermomixer ...
-
bioRxiv - Genomics 2024Quote: ... These libraries were then sequenced to produce 150-bp paired-end reads using a NovaSeq 6000 instrument (Illumina, USA) by Novogene ...
-
bioRxiv - Genomics 2024Quote: ... A pre-index anchor was ligated and a PCR amplification step with 15 cycles was done to add a 10bp unique dual index adapter sequences (IDT® for Illumina® RNA UD Indexes, Ligation). All libraries were quantified by Qubit dsDNA HS Assay measurement ...
-
bioRxiv - Genomics 2024Quote: ... using a NextSeq 500/550 High Output Kit v2.5 (Illumina). First ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA libraries were prepared according to a standard protocol and sequenced on MiniSeq platform (Illumina) with paired-end 150 cycles (75 + 75) ...
-
bioRxiv - Genetics 2024Quote: ... We then tagmented cDNA using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096), starting with 550 pg of cDNA pooled in equal amounts ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... BCL Convert Software (Illumina) was used to generate de-multiplexed FASTQ files and CellRanger 7.0.1 (10X Genomics ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Paired-end 100-base sequencing was conducted on the NextSeq 2000 P3 sequencing platform (Illumina, CA, USA). Reads were trimmed using trimmomatic v0.39 (83 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were pooled equimolarly and sequenced using 150 bp paired end reads on a NovaSeq S1 flowcell (Illumina, California, USA) at the Biomolecular Resource Facility within the John Curtin School of Medical Research ...
-
bioRxiv - Biochemistry 2024Quote: ... For indexing Unique Dual Indexes (20040553/20040554, Illumina Inc.) were used ...
-
bioRxiv - Evolutionary Biology 2024Quote: All samples were sequenced using the same sequencing protocol (100bp paired-end) and platform (Illumina HiSeq). Sequencing depth was generally shallow (2-5× ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using paired end sequencing (Illumina NextSeq500, 75 cycle sequencing module) to generate an average of ∼28.6 million reads per sample (Data S1) ...
-
bioRxiv - Genetics 2024Quote: ... libraries were prepared using EpiGnome™ Methyl-Seq reagents (Illumina, Inc, San Diego, CA), index-tagged for multiplexing ...
-
bioRxiv - Genetics 2024Quote: ... and imaged with the Illumina iScan SQ instrument (Illumina, Inc., San Diego, CA) to obtain raw image intensities ...
-
bioRxiv - Bioengineering 2024Quote: ... Library preparation of the samples was performed using the Nextera XT (Illumina, San Diego CA, USA) kit ...
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Genomics 2024Quote: ... DNA libraries were prepared (TruSeq Nano DNA HT kit, Illumina), characterized with regards to size (LabChip DX Touch ...
-
bioRxiv - Genomics 2024Quote: ... 0.01% digitonin) and 2.5μl of Tn5 from Nextera DNA Library Preparation Kit (Illumina) for 45-75min at 37°C in a thermomixer (500 RPM shaking) ...
-
bioRxiv - Genomics 2024Quote: 50X WGS (Illumina; 150 bp paired-end) generated from the blood or skin fibroblasts of the 273 iPSCORE subjects6.
-
bioRxiv - Developmental Biology 2024Quote: ... The TruSeq Stranded mRNA protocol (Illumina, Inc, California, USA) was used in the succeeding steps ...
-
bioRxiv - Developmental Biology 2024Quote: ... library preparation was done following the CEL-Seq2 protocol43to prepare a cDNA library for sequencing using TruSeq small RNA primers (Illumina). The DNA library was paired-end sequenced on an Illumina Nextseq™ 500 ...
-
bioRxiv - Immunology 2024Quote: ... The libraries were diluted to 2nM and pooled for paired-end sequencing (Read1: 51bp, Read2: 71bp + i7 Indexes: 8bp) on a NovaSeq 6000 S Prime sequencer (Illumina, San Diego, CA) at the SNP&SEQ Technology Platform (Uppsala ...
-
bioRxiv - Evolutionary Biology 2024Quote: Library preparation (directional, with poly-A enrichment) and sequencing (Illumina, PE150) of A ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... two paired-end libraries (500 bp) were constructed according to the manufacturer’s protocols (Illumina) and sequenced on the Illumina HiSeq 2500 sequencing platform ...
-
bioRxiv - Genomics 2024Quote: ... NextSeq or NovaSeq sequencing platforms (Illumina, San Diego, CA). Bioinformatic analysis on fastQ resulting files were performed as previously described Martinez et al 2020 supplementary material ...
-
bioRxiv - Genomics 2024Quote: ... The protocol outlined above (Estimation of barcoded variant coverage by Illumina sequencing section) was used to amplify each sample with the following changes ...
-
bioRxiv - Developmental Biology 2024Quote: ... and sequenced on the Illumina NextSeq 500 using High Output Kit v2.5 (150 cycles, Illumina) for 2 × 75 bp paired-end reads with 8 bp single index aiming sequencing depth of >20,000 reads per cell for each sample.
-
bioRxiv - Developmental Biology 2024Quote: ... sequencing was performed at The McDermott Center Next Generation Sequencing (NGS) Core at UT Southwestern using TruSeq Stranded mRNA Sample Preparation Kit (Illumina). The reads were then used as reference of single organoid ribo-seq under same condition ...
-
bioRxiv - Developmental Biology 2024Quote: Sequencing was performed by NextSeq 500 (Illumina) with 150 cycles of 28 x 91 paired-end reads ...