Labshake search
Citations for Illumina :
351 - 400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The sequencing was performed using the Illumina MiSeq (2 × 300 bp) platform (Illumina Inc., USA) at Macrogen Inc ...
-
bioRxiv - Microbiology 2024Quote: ... The following index PCR for both gene libraries was conducted with the Nextera XT index kit v2 (Illumina Inc., USA). The PCR product was purified using the LabopassTM DNA purification kit (Cosmogenetech Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed on the Illumina NextSeq 500 Platform (Illumina, San Diego, CA, USA) via 2 * 150 bp paired-end sequencing protocol243.
-
bioRxiv - Molecular Biology 2024Quote: ... including PCR cycles (12 cycles for cDNA amplification of 5000 cells and 14 cycles for index PCR. E13.5GE libraries from Evf2+/+and Evf2TS/TS were sequenced on the Illumina NovaSeq 6000 (Sequencing Core Facility at the La Jolla Institute).
-
bioRxiv - Microbiology 2024Quote: ... V3–V4 region of the 16S rRNA gene were amplified using the primer set 341F– 785R (Klindworth et al. 2013) and sequenced using Illumina MiSeq 2 x 300 bp (Illumina Inc., San Diego, CA, United States). Demultiplexed and adapter clipped reads obtained from LGC Genomics were processed as mixed ones ...
-
bioRxiv - Microbiology 2024Quote: ... Between 3-5 µg of total RNA from each sample was used for mRNA enrichment with the RiboZero Bacterial rRNA Removal Kit (Illumina, San Diego, CA, USA), and the quality and quantity of enriched mRNA was assessed as described above for total RNA ...
-
bioRxiv - Microbiology 2024Quote: Demultiplexed sequenced samples were saved as FASTQ files using BCL2FASTQ software (Version 2.20, Illumina, CA, USA). Sequences with barcode mismatches ...
-
bioRxiv - Microbiology 2024Quote: ... TruSeq libraries were prepared using the RNA Sample Prep Kit v2 and sequenced on an Illumina HiSeq 2000 (Illumina). Output reads were trimmed and assessed for quality control prior to mapping against the M ...
-
bioRxiv - Microbiology 2024Quote: ... The fluorescent images were processed into sequences and transformed to FastQ format using the Genome Analyzer Pipeline Analysis software 1.8.2 (Illumina). The sequence output was controlled for general quality features ...
-
bioRxiv - Microbiology 2024Quote: ... Illumina sequencing was performed with the NovaSeq 6000 sequencing system (S1 flow cell, Illumina) with 100 cycles and paired-end reads (PE50 ...
-
bioRxiv - Microbiology 2024Quote: ... From the total RNA the rRNA was depleted using Ribo-Zero (Illumina). ERCC spike-ins (external RNA controls consortia Mix 1 and Mix 2 ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced at 100 bp paired-end using an Illumina NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles; Illumina) on an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Microbiology 2024Quote: ... The quality of the sequencing run was assessed using Illumina Sequencing Analysis Viewer (Illumina version 2.4.7) and all base call files were demultiplexed and converted into FASTQ files using Illumina bcl2fastq conversion software v2.20 ...
-
bioRxiv - Microbiology 2024Quote: ... mRNA was used to generate the cDNA library according to the NEBNext® UltraTM II RNA Library Prep Kit protocol (Illumina), which was then sequenced using the Illumina HiSeq 2000 system ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were sequenced by Illumina HiSeq 2500 and the reads were mapped to mm10 library (ensembl v98) ...
-
bioRxiv - Microbiology 2024Quote: Libraries for Illumina short read sequencing were prepared from 1 ng of extracted DNA utilizing the Nextera XT DNA Library Prep Kit according to the manufacturer’s recommendations (Illumina Inc., USA). Sequencing was carried out in paired-end (2×300 base pairs ...
-
bioRxiv - Microbiology 2024Quote: The whole genome sequencing was carried out on the MiSeq instrument (Illumina, USA) using a MiSeq reagent kit V3 with 2×250-bp reads ...
-
bioRxiv - Immunology 2024Quote: ... TrueSeq stranded mRNA libraries (Illumina) were prepared by the Single Cell Genomics Core at Johns Hopkins University and sequenced on an Illumina NovaSeq platform (1x100bp reads) ...
-
bioRxiv - Genetics 2024Quote: ... immobilized and processed onto a flow cell with a cBot (Illumina) followed by sequencing-by-synthesis with TruSeq v3 chemistry on a HiSeq2500 performed at the Max Planck Genome Center CGC (Cologne ...
-
bioRxiv - Genetics 2024Quote: ... with either the TruSeq® DNA Library Prep Kit (Illumina, Inc.) (selection Generation 18 samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina) using v2 chemistry ...
-
bioRxiv - Molecular Biology 2024Quote: Sequencing was performed on the NextSeq1000/2000 (Illumina). Resulting reads were aligned to the GRCh38 genome assembly using Bowtie2 (v2.4.5)68 with the parameters –local and –very-sensitive ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼1ug of rRNA-depleted (RiboZero, Illumina, NB: no longer available) RNA from wild type BY4741 or spp382-1 yeast or ∼3 ug of total RNA from BY4742 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 cycle sequencing kit v1.5 (Illumina Inc.). Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Molecular Biology 2024Quote: ... Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Neuroscience 2024Quote: ... Sequencing of the libraries was carried out using HiSeq X Ten (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... The V4 – V5 region of the 16S rRNA gene was amplified with the 515F/926R primer pair (45,46) and sequenced on the MiSeq platform (Illumina, Inc., San Diego, CA).
-
bioRxiv - Microbiology 2024Quote: ... v2 Kit (Illumina Inc.), resulting in high-quality reads ranging from 11 to 17 million reads per sample (Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA-Seq libraries were generated from 200 ng of total RNA using TruSeq Stranded mRNA Library Prep Kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA libraries were sequenced using NovaSeq6000 (Illumina) at LabGenomics (Seongnam ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was submitted to the University of Michigan Advanced Genomics Core for library preparation and RNA-sequencing (Illumina NovaSeq platform ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed by GenoScreen (Lille, FR) on MiSeq (Illumina 2*250 bp) using the MiSeq reagent kit v2 (500 cycles).
-
bioRxiv - Microbiology 2024Quote: ... and NextSeq (Illumina) genome sequencing instrument was used to sequence the samples ...
-
bioRxiv - Microbiology 2024Quote: ... regions ITS1-ITS2 were constructed using a dual-indexing method and sequenced on a MiSeq platform with a 2x300 bp run format (Illumina, San Diego, CA) at the University of Wisconsin – Madison Biotechnology Center ...
-
bioRxiv - Microbiology 2024Quote: ... followed by library preparation using the Illumina DNA Prep kit (Illumina, San Diego, CA) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... Library preparations were made using the Nextera Flex Prep HT kit (Illumina) and samples were then sequenced on the Illumina NovaSeq X-Plus (300 cycles).
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled and run on a NovaSeq 6000 (Illumina) with V1.5 sequencing kits for 151 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... and shotgun-sequenced using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina, San Diego, CA, USA). For each phage ...
-
bioRxiv - Developmental Biology 2024Quote: ... The final pools were sequenced on NovaSeq 6000 platform using SP Reagent Kit v1.5/ 100 cycles (Illumina) with 28×8×91 configuration run leading to 40000 reads/cell.
-
bioRxiv - Developmental Biology 2024Quote: ... Multiplexed libraries were sequenced using a NextSeq 500 (Illumina) to generate 75-nt single-end reads ...
-
bioRxiv - Microbiology 2024Quote: Paired FASTQ files from Illumina paired-end sequencing were merged using AdapterRemoval67 (v ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The library was sequenced on an Illumina NextSeq500 instrument with a high-output mode (Illumina, 20024907) 150bp paired-end reading strategy according to 10X recommendations.
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequencing was carried out on the NextSeq 500 platform (Illumina) employing the paired-end 36-base read option ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... The RNA was treated with the QIAseq FastSelect 5S/16S/23S rRNA removal kit prior to library prep with the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA). The Illumina HISeq 4000 was used for sequencing at 50bp single-end reads.
-
bioRxiv - Microbiology 2024Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc., San Diego, USA). DNA was fragmented and amplified by limited PCR (12 cycles) ...