Labshake search
Citations for Illumina :
101 - 150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... clean reads (i.e. Illumina) were input into NextPolish v.1.4.1 [57] to polish the complete genome ...
-
bioRxiv - Microbiology 2024Quote: ... Ribo-Zero Plus Kit (Illumina) was employed for host ribosomal RNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Microbiology 2024Quote: ... Demultiplexed and adaptor-trimmed reads generated by Illumina analytical tools were used for further processing.
-
bioRxiv - Microbiology 2024Quote: ... All libraries were prepared using the TruSeq Total RNA Library Preparation Protocol (Illumina). Ribo-Zero Plus Kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end 150-bp sequencing was performed using the NovaSeq6000 system (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... Paired-end 150-bp sequencing was performed using the NovaSeq6000 system (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... and sequenced with a MiSeq instrument using MiSeq reagent kit V2 (Illumina). 150 bp paired-end reads were assembled with SPAdes (v3.15.557 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5µl of ATM (Illumina XT DNA sample preparation kit ...
-
bioRxiv - Microbiology 2024Quote: ... gDNA samples were converted to Illumina sequencing libraries using Illumina’s DNA Prep Sample Preparation Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Some of the greenCUT&RUN libraries were sequenced on the MiniSeq (Illumina, 6–8 Mio reads per sample and 1/3 of reads for the controls).
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared using the Illumina Stranded mRNA Prep kit (Illumina, 20040534) with a starting amount of 100 ng high quality total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced 51bp paired-end on a NovaSeq6000 instrument (Illumina), 75bp paired-end on a NextSeq2000 device (Ilumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced on NovaSeq 6000 System S1 flowcell (Illumina). Approximately 40 million 100 bp paired-end reads were generated from each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-Seq libraries were then constructed using TruSeq RNA Library Prep Kit v2 (Illumina, San Diego, CA) and sequenced on NovaSeq 6000 System S1 flowcell (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were pooled in equal quantity and sequenced using Illumina HiSeq 2500 (Illumina) to produce 20 million paired-end reads (50×50 bases ...
-
bioRxiv - Molecular Biology 2024Quote: Immunoprecipitated DNA and input libraries (two replicas each) were prepared using TruSeq ChIP Library Preparation kit following the manufacturer’s instructions (Illumina) and checked for concentration and quality on DNA chips with a Bioanalyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 75-bp single read sequences were generated on the NextSeq 500 sequencer according to manufacturer’s instructions (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... and RNA-seq libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit from Illumina (NEB, E7770) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced to 50 million reads per sample on a NovaSeq 6000 (Illumina) paired end 100 bp and reads processed using bcl2fastq version ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were pooled and sequenced on a NovaSeq 6000 (Illumina) at the Yale Center for Genome Analysis.
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was conducted on a NextSeq 2000 (Illumina) sequencer at loading concentration of 750 pM using a P3 200 kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Integrated DNA technology (IDT) RNA unique dual UD Indices (Illumina) as recommended ...
-
bioRxiv - Microbiology 2024Quote: ... following the Illumina Nextera XT DNA Library Preparation protocol (Cat. FC-131-1024, Illumina, CA, USA). For DNA tagmentation ...
-
bioRxiv - Microbiology 2024Quote: ... using the Nextera XT DNA Library Preparation kit (Illumina) (Data set S1 ...
-
bioRxiv - Neuroscience 2024Quote: Reads were demultiplexed with CASAVA (Illumina) and read quality was assessed using FastQC (https://www.bioinformatics.babraham.ac.uk/ ...
-
bioRxiv - Plant Biology 2024Quote: ... and sequenced all 18 libraries on a NovaSeq 6000 (Illumina, Inc. San Diego, CA) using a single S4 flow cell lane ...
-
bioRxiv - Plant Biology 2024Quote: ... A total of 30-50 ng of genomic DNA per individual was used for SNP genotyping by the INRA-EPGV group using the Illumina BeadArray platform of the Genotyping National Center, CNG (CEA-IG, Evry, France) and following the GoldenGate Assay manufacturer’s protocol (Illumina Inc., San Diego, CA, USA). Three assays ...
-
bioRxiv - Plant Biology 2024Quote: ... where libraries were prepared using TruSeq stranded mRNA kit (Illumina). Resulting libraries were sequenced on the NovaSeq 6000 (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using a Nextera XT DNA Library Preparation Kit (Illumina), using a standard protocol but with all reaction volumes reduced by 1/10 to accommodate the automation of the prep on the Echo LabCyte liquid handler (Beckman) ...
-
bioRxiv - Synthetic Biology 2024Quote: Sequencing reads from Illumina NextSeq platforms are first demultiplexed using BCL2fastq software (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... Resulting libraries were sequenced on the NovaSeq 6000 (Illumina) with 2×150 bp paired-end read chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... we assessed SNP genotype quality across individuals using the methodology proposed by Illumina (Tindall et al 2010). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... clustering and genotype calling were performed using the genotyping module of the BeadStudio/GenomeStudio package (Illumina, San Diego, CA, USA) with a GeneCall score cutoff of 0.25 to obtain valid genotypes for each individual at each SNP.
-
bioRxiv - Cell Biology 2024Quote: ... Raw sequencing reads were filtered by Illumina NovaSeq Control Software and only the Pass-Filter (PF ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... FASTQ files were generated using Basespace software (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... and then turned into sequencing libraries using the Nextera kit (Illumina, CA) to include only the poly-A tail adjacent 3’ ends of RNA transcripts ...
-
bioRxiv - Cell Biology 2024Quote: ... Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina’s bcl2fastq 2.17 software ...
-
bioRxiv - Systems Biology 2024Quote: mRNA and miRNA data were produced by Illumina and Exiqon microarray technologies respectively 10 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Evolutionary Biology 2024Quote: The transcriptome was sequenced using Illumina HiSeq 2000 2x150bp platform from cDNA libraries prepared using TruSeq RNA sample prep kit v2 (Illumina, San Diego, CA) at Macrogen Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by library preparation using the Nextera XT DNA Library Prep kit (Illumina, San Diego, CA, USA), both according to manufactures’ protocols ...
-
bioRxiv - Genetics 2024Quote: ... and sequencing (Illumina HiSeq 2 x 150 bp) of the control sample were completed by GENEWIZ (New Jersey ...
-
bioRxiv - Genetics 2024Quote: ... flanked by Illumina partial adapter sequences ...
-
bioRxiv - Neuroscience 2024Quote: ... The AmpliSeq protocol (Illumina, San Diego, CA, USA) was used in subsequent steps ...
-
bioRxiv - Neuroscience 2024Quote: ... two different library preparation kits were used: the TruSeq Stranded mRNA Kit (Illumina; short read sequencing) and the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara Bio USA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing was performed on a MiSeq (Illumina Inc., San Diego, CA), yielding an average of 6,801 (section 29 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pooled libraries were sequenced with paired-end 250 bp reads in a single flow cell on an Illumina MiSeq (Illumina Inc., San Diego, CA) in case one and an Illumina HiSeq 4000 in case two ...