Labshake search
Citations for Illumina :
301 - 350 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... including a 10% PhiX spike-in (Illumina) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries underwent sequencing on the HiSeq platform (Illumina, San Diago, CA, USA) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... the flowcell was loaded on the Illumina NovaSeq 6000 instrument according to manufacturer’s instructions (Illumina). Sequencing was performed using a 2×150 Paired End (PE ...
-
bioRxiv - Cancer Biology 2024Quote: ... NEB NextUltra DNA Library Preparation kit was used following the manufacturer’s recommendations (Illumina). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 300 cycles (Illumina). FASTQs generated were analysed with the ‘UMI4Cats’ R package to generate contact maps against the IRX3 proximal promoter (49).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced on a MiSeq (Illumina) with a MiSeq Reagent Nano Kit v2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HiSeq X Ten (Illumina, USA), or NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... or NovaSeq 6000 (Illumina, USA) as 100bp or 150bp paired-end sequencing with a median coverage of 47x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Raw sequence data generated from Illumina NextSeq 500 were converted to FASTQ files and Quality control analysis was performed on fastq files using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100-500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA HT Kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were barcoded and run on a HiSeq (Illumina) in a 75-bp SE run ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced (Illumina HiSeq). Reads were mapped to the mouse genome ...
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100-500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA HT Kit, Illumina #20020595), with 15 cycles of PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pellet of nuclei was subjected to transposition with Nextera Tn5 transposase (Illumina #FC-121–1030) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Approximately 50 million paired-end 150-bp reads (25 million each side) were sequenced per replicate on a HiSeq instrument (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... pooled and paired-end sequenced on Novaseq-6000 sequencer (Illumina) at Gustave Roussy ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shallow whole genome sequencing (sWGS) was performed on a HiSeq4000 system (Illumina Cambridge, UK), using paired-end 150 bp protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was sequenced on a NovaSeq 6000 (Illumina) using 150 paired-end cycle reads with 50 million paired reads per sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... PIK3CA was performed using a custom Ampliseq panel on a HiSeq4000 system (Illumina, Cambridge, UK), using paired-end 150 bp protocols [9] ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were constructed by the Sequencing Facility at NCI-Leidos using the TruSeq Stranded mRNA Kit (Illumina, San Diego, CA) and sequenced in a paired-end manner on NextSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced in a paired-end manner on NextSeq (Illumina) with 2 x 101 bp read lengths ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final libraries were quantified by qPCR using Library Quant Standards (Illumina) and pooled in equimolar amount for paired-end 75bp sequencing on an Illumina MiSeq platform.
-
bioRxiv - Cancer Biology 2024Quote: PolyA mRNA was enriched from total RNA and constructed into a library for RNA-seq using the Stranded Total RNA Prep with Ribo-Zero Plus Kit (Illumina). cDNA libraries were sequenced using paired-end 150bp on the Illumina NovaSeq 6000 platform at 50 million reads per samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were generated using the Nextera XT Library Prep kit (Illumina) with custom indexing adapters64 in a 384-well PCR plate ...
-
bioRxiv - Cancer Biology 2024Quote: ... Combined libraries from different cells were then sequenced on a NextSeq 500 sequencer (Illumina), using paired-end 38-base reads.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries prepared with the Illumina TruSeq stranded mRNA kit (Illumina) following the manufacturers’ instructions at the DFCI core facility ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries were processed for rRNA removal (QiaSelect) and prepared with the Illumina TruSeq stranded mRNA kit (Illumina) following the manufacturers’ instructions at DFCI core facility ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were sequenced for 600 cycles using the MiSeq reagent kit v3 (Illumina). After trimming with Cutadapt (72) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For library preparation the TruSeq Stranded mRNA kit (Illumina) was selected and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... The library was sequenced on a NextSeq 500 (Illumina) (59 cycles in read1 and 16 cycles in read2) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Paired-indexed (Nextera XT indices, Illumina) and magnetic bead-purified (AMPureXP ...
-
bioRxiv - Cancer Biology 2024Quote: ... was selected and sequenced on a NextSeq 500 (Illumina) using the NextSeq 500/550 High Output Kit v2.5 (150 cycles) ...
-
bioRxiv - Cell Biology 2024Quote: ... Sequencing was performed using an Illumina 6000 (Illumina, USA) with 150-bp paired-end reads ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were sequenced on a NovaSeq 6000 (Illumina) with the S2 100 cycle kit targeting 50,000 reads per cell.
-
bioRxiv - Cell Biology 2024Quote: The raw sequencing reads from Illumina were aligned to the mouse reference genome mm10 using Cell Ranger V4 software (RRID:SCR_017344 ...
-
bioRxiv - Cell Biology 2024Quote: ... Barcoded libraries were then pooled and sequenced on the HiSeq2000 (Illumina) using TruSeq SBS Kit v4 reagents ...
-
bioRxiv - Cell Biology 2024Quote: ... The single cell RNA library was sequenced by Illumina HiSeq X Ten instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... The high-throughput sequencing of the samples was done using HiSeq2000 (Illumina, Inc) technology ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were sequenced on the NextSeq500 instrument (Illumina) using the NextSeq 300-cycle high output kit (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... All RNA-seq samples were sequenced paired-end on NovaSeq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina’s bcl2fastq 2.20 software ...
-
bioRxiv - Genetics 2024Quote: ... immobilized and processed onto a flow cell with a cBot (Illumina) followed by sequencing-by-synthesis with TruSeq v3 chemistry on a HiSeq2500 performed at the Max Planck Genome Center CGC (Cologne ...
-
bioRxiv - Genetics 2024Quote: ... with either the TruSeq® DNA Library Prep Kit (Illumina, Inc.) (selection Generation 18 samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina) using v2 chemistry ...
-
bioRxiv - Molecular Biology 2024Quote: Sequencing was performed on the NextSeq1000/2000 (Illumina). Resulting reads were aligned to the GRCh38 genome assembly using Bowtie2 (v2.4.5)68 with the parameters –local and –very-sensitive ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼1ug of rRNA-depleted (RiboZero, Illumina, NB: no longer available) RNA from wild type BY4741 or spp382-1 yeast or ∼3 ug of total RNA from BY4742 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Microbiology 2024Quote: ... The V4 – V5 region of the 16S rRNA gene was amplified with the 515F/926R primer pair (45,46) and sequenced on the MiSeq platform (Illumina, Inc., San Diego, CA).