Labshake search
Citations for Illumina :
501 - 550 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... using a NextSeq550 platform (Illumina, San Diego, CA, USA) with the Mid Output Kit v2 (300 cycles) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Microbiology 2024Quote: ... the 16S rRNA gene V3 region was amplified using the Nextera Index Kit (Illumina, CA, USA) compatible forward primer nxt388_F:(5’-TCGTCGGCAG CGTCAGATGT GTATAAGAGA CAGACWCCTA CGGGWGGCAGCAG-3’ ...
-
bioRxiv - Microbiology 2024Quote: ... we now performed hybrid sequencing (Illumina and Nanopore) for isolates 5A-D ...
-
bioRxiv - Microbiology 2024Quote: ... An equal amount of DNA from each library was pooled and sequenced using 150 bp paired-end settings on an NextSeq550 platform (Illumina, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... Approximately 5 µg of polyA+ RNAs were used for further rRNA removal using the Ribo-Zero kit from the TruSeq Stranded Total RNA LT Kit (Illumina). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was performed using NextSeq-500 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Illumina 50 Single-End sequencing in biological replicates ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by Illumina 150 Paired-End sequencing in biological replicates ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing of pooled libraries was done using a NextSeq 500 (Illumina) and sequence reads were aligned to a combination of the human genome reference (GRCh38 ...
-
bioRxiv - Genetics 2024Quote: ... immobilized and processed onto a flow cell with a cBot (Illumina) followed by sequencing-by-synthesis with TruSeq v3 chemistry on a HiSeq2500 performed at the Max Planck Genome Center CGC (Cologne ...
-
bioRxiv - Genetics 2024Quote: ... with either the TruSeq® DNA Library Prep Kit (Illumina, Inc.) (selection Generation 18 samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina) using v2 chemistry ...
-
bioRxiv - Molecular Biology 2024Quote: Sequencing was performed on the NextSeq1000/2000 (Illumina). Resulting reads were aligned to the GRCh38 genome assembly using Bowtie2 (v2.4.5)68 with the parameters –local and –very-sensitive ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼1ug of rRNA-depleted (RiboZero, Illumina, NB: no longer available) RNA from wild type BY4741 or spp382-1 yeast or ∼3 ug of total RNA from BY4742 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The libraries were combined with the PhiX Control v3 (Illumina), and 250 bp of both ends were sequenced on the MiSeq platform (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dual indices and Illumina sequencing adapters were attached to the amplicons with index PCR using Nextera XT Index Kit v2 (Illumina). The libraries were combined with the PhiX Control v3 (Illumina) ...
-
bioRxiv - Developmental Biology 2024Quote: ... All cDNA libraries were generated from 1 µg total RNA using the TrueSeq Stranded Total RNA Library Preparation Kit with the Ribo-Zero Gold Kit according to the manufacturer’ ss instructions (Illumina Inc., San Diego, CA, USA). Quality and quantity of the cDNA libraries were assessed using a TapeStation 4200 (D1000 screen tape assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pair-end sequenced targeting 35,000 reads per cell using NovaSeq PE150 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... 0.003 μl Tagmentation DNA Enzyme 1 (TDE1; Illumina DNA sample preparation kit) to the 1μl of diluted cDNA per well ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were resuspended in 50 µl transposition reaction mix with Nextera Tn5 Transposase (Illumina, FC-121-1030) and incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... AMPure beads (Beckman Coulter, A63880 were used to remove primer dimers and libraries were sequenced on a NextSeq 500 instrument (Illumina) to generate 75 bp single-end reads.
-
bioRxiv - Molecular Biology 2024Quote: ... up to 50% PhiX phage DNA (Illumina) was mixed with the libraries to assist the sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Molecular Biology 2024Quote: ... Transposition was performed directly on nuclei following manufacturer recommendations (Tn5 Illumina) at the molecular biology and functional genomics platform of the Institut de Recherche Clinique de Montréal (IRCM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced the libraries on a NextSeq 500 instrument (Illumina) to generate 150-bp paired-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ChIP-seq library preparation using ThruPLEX kit (Rubicon, R400427) and sequenced using NextSeq 500 instrument (Illumina) to produce 75-bp single-end reads.
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... HiSeq 4000 or NovaSeq 6000 instruments (Illumina, San Diego, CA, USA), in paired-end mode ...
-
bioRxiv - Molecular Biology 2024Quote: ... The libraries were sequenced on an Illumina Hiseq 2500 platform (Illumina, Inc.) using single-end 50 bp reads.
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-seq libraries were constructed from qualified RNA samples using TruSeq Stranded mRNA Library Prep Kit (Illumina). RNA-seq was performed on an Illumina Nova Seq 6000 platform with a 101 bp paired-end protocol.
-
bioRxiv - Molecular Biology 2024Quote: The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library of polyA-containing mRNA (350 bp size) was prepared using TruSeq Stranded mRNA Library Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA eluted and purified was sequenced (sequencing single-reads, 1 × 50 bp or paired-end 100bp; Illumina) of the resulting input and IP samples performed by BGI ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing was carried out on a NovaSeq600 using an SP 100 cycle kit (Illumina).
-
bioRxiv - Immunology 2024Quote: ... Texas A&M Institute for Genome Sciences and Society (College Station, TX, USA) constructed sequencing libraries for each sample using a standard protocol (Illumina, San Diego, CA). RNA-Seq library quality was assessed with the Cutadapt package and mapped to the equine genome using the HISTAT2 package ...
-
bioRxiv - Genomics 2024Quote: ... we used primers flanking both sgRNA scaffolds and sequenced on a 300-cycle sequencing kit (e.g. Illumina MS-102-2002). For subsequent library sequencing without quantification of deletion events ...
-
bioRxiv - Molecular Biology 2024Quote: ... the libraries were sequenced on the Illumina Hiseq 4000 platform (Illumina, Inc., San Diego, CA) using 150 bp paired-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... and imputation was performed using the GSE40279 dataset (Illumina 450k) used in his original manuscript ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in incorporation mix (MiSeq Nano kit v2 reagent 1) (Illumina MS-103-1003) for 5 minutes at 60 °C on a flat-top thermal cycler ...
-
bioRxiv - Genomics 2024Quote: ... then washed six times with PR2 buffer (Illumina MS-103-1003), followed by 5 heated washes in PR2 ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing was performed on an Illumina NovaSeq 6000 PE150 platform (Illumina Inc. San Diego, CA, USA), and 150 bp paired-end raw files were obtained ...
-
bioRxiv - Genomics 2024Quote: ... using a MiSeq Reagent kit v2 (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2024Quote: Raw base call files were obtained from Illumina BaseSpace or AVITI storage and were used to generate fastq files using bcl2fastq v2.20.0.422 or bases2fastq version 1.5.0.962525890 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Genomics 2024Quote: ... the paired-end (PE 150bp) library was generated using the Illumina TruSeq DNA Nano Preparation Kit (Illumina, San Diego, CA, USA), and the library was sequenced on an Illumina HiSeq 2500 platform following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Bacterial populations in psyllids were analyzed using the MiSeq system (Illumina), as described previously (Nakabachi ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 250 bp of both ends were sequenced on the MiSeq platform (Illumina) with MiSeq Reagent Kit v2 (500 cycles ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... both library generation (NGS DNA Library Prep set-Novogene) and sequencing (Illumina NovaSeq 6000 S4 flowcell-Illumina) were performed by Novogene Co ...